Query (optional)   in Class  

GrainGenes Probe Report: BE500453-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE500453-6B
Data at Wheat_SNP
BE500453-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;A>C at 28;158
SNP DEL at 580-581
Reference sequence CCCTGCTATTTCATCTTCCAGATCTCCAGATCTGTTCTACTCTCTGCTCAGCTTTTGTGGTTTCGTCCGGGTTTCTTAGTTTGTCTCGTGCCTGTTTCGCAGGTCTGAGTTCAGGCAGCAGTATAACGCGGAGAACCCCAACAACAAGAGTGTCGCCAACGTGAGCCACCTTGCACTGTTTTCTTTTCACTTTTATCTTCGCTTGTATAGACATCTCAAACTGCTTTTGCCGTGCTGAGTGATTAGGTGAGCAGGGCAGCGGGTGAGAAGTGGAGAGCTATGTCTGATGAGGTGAGTGCATCTTGCAATGCTCAAACTAGTCTCTGCATAGATCTTTCCTAGTGTACTTACCTGTTACTGTACTTTTTAAACATACCTAAGCTGCACATAATTACAGATTTTGTTCTTCAATGTATATTTATGTGAATTGGCTCAGTTGTAACTGAATAGTTGAATGCAATCTGCACATCTGTTTGTTCCAATAAACAACATATTTGTTACCGGGCGGCATGATTAACGTACTATATATTTGGTGTATTGACCGGTTTAATTTGTTAGGACAAAGCACCTTATGTGGAAAAGGCTGAACAGAAGAAGAAGGACTATGAGAAGACCAAAGCCACCTTTGATAACAAGGTAACCTTGGGATCATGGTGCATGTTCTTCCAATTGTGAAGGTTACAAAGTTTTAGTGCTAATTTGACATATCTAATTCTTTCAGGAGAGTGCGACTTCCAAGAAGGCCAAGACTCAGAACGGTGAGGAGGTCAAATCTGAGGTCGAAGATGAGGGTAGCAATGAGGTAAAAACATTTAAGCATTTTGGTTGATGGTTTATGTTTGTAGCGCCCAATGATGTTTACCCGCTAGTGTTTTTAGTGACAC
Reference sequence AGCGCCCGCCCTCCGCCTTCTTCGTCTTCATGTGAGCCCTGGCTCTCTGGCCCTGCTATTTCATCTCCCAGATCTCCAGATCTGTTCTACTCTCTGTTCAGCTTTTGTGGTTTCGTCCGGGTTTGTTAGTGTATCTTGTGCCTGTTTCGCAGGTCTGAGTTCAGGCAGCAGTACAACGCGGAGAACCCCAACAACAAGAGCGTCGCCAACGTGAGCCACCTTGCACTGTTTTCTTTTCACTTTTATCTTCGCTTGTATAGACATCTCAAACTGCTTTTGCCATGCTGAGTGATTAGGTGAGCAAGGCGGCGGGTGAGAAGTGGAGAGCTATGTCTGATAAGGTGAGTGCATCTTGCAATGCTCAAACTAGTCTCTGCATAGATCTTTCCTAGTGTACTTATCTGTTACTGTACTTATTAAACATACCTAAGCTGCACATAATTACAGATTTTGTTCTTCAATGTATATTTATGTGAATTGGCTCAGTTGTAACTGAATAGTTAAATGCAATCTGCACATCTGTTTGTTCCAATAAACAACATATTTGTTACCGGGTGGCATGATTAACGTACTGTATATATTTGGTTTATTGACCGGTTTAATTTGTTAGGACAAAGCACCTTATGTGGAAAAGGCTGAACAGAAGAAGAAGGACTATGAGAAGACCAAAGCCACCTTTGATAACAAGGTAACCTTGGGATCATGGTGCATGCTCTTCCAATTGTGAAGGTTACAAAGTTTTAGTGCTAA
Type
EST
SNP
PCR primers
BE500453B_R3_UCD AGTCTTGGCCTTCTTGGAAG
BE500453_cpF1_UCD CAGCAAGAGGAAGAAGGACG
Sequence
NSFT03P2_Contig15883
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01