Query (optional)   in Class  

GrainGenes Probe Report: BE500759-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE500759-3B
Data at Wheat_SNP
BE500759-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>G at 138;551
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE500759B_F1 CAATTTTGTGTCCCGTAGGAA
BE500759_cpR1 GAAGCTCGCCAAAGATTGAC
BE500759B_R1 TGGAGTGCACAAATCATATCAAT
BE500759_cpF1 GACTACTGCACGCACCAGAA
Sequence
NSFT03P2_Contig5225
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01