Query (optional)   in Class  

GrainGenes Probe Report: BE517805-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE517805-1A
Data at Wheat_SNP
BE517805-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;A>G;G>T;T>G;DEL;A>C;G>A;A>T;C>G;T>C;T>C;T>A at 84;85;86;89;120;147;270;417;551;555;679;1378
Reference sequence GCAAATGGTCCGAATATGAGACCTGCCAATTCATATCAGAGAGGTTATTTCTGTTCAACGACGCTGTTGCAGTTCCTGCCACATAGTTTATGGTCAAAATTGTGCAGTACATTCATACCGTGGTTTACAACATATCCTTTCAGCATATCAATAAGATCCCGACGCCTATCCGTGTCAAATCTTTTAATTTCAGTCGTGTTATTTTCCTGCATTCAATATAGAGAAGGTAAATGGCAGAGGGGCGAAATTATAATTCTTTCGGATGCAGCGGGGTTCCAAAATTCAGTAACACACACTCCCAACATCCCAGAGGCCTGCAAAAAATTGATGTGCCAACTCCACACAAGAAATCAACCTCCACCCATTTTTCTAACTCAAAAAATGATCCTGCAGTTTGTACCATTGTCCGCATACCCAGAAAATACGTGTTGAAACTCCAAAAAAGACGCATATACGTGATGATCCACTCCCAGGATCTTAGCACAAAGACAAAGACCACCCTCTGGGATCTCTTAAAGCAAAGCAATATGTTATCATAGAAAGCCTAGTACGCATACATAATCTACCTGATCAGTCATTTAAATTTTGGGAAACTCTTAAAAAATTGAAGAGAATTATTTTTTTTTGCAGCAGCAATAGCTCAACTAACACATTATATGTGGATTAGCATGTACTCCCTCCGCTCCTAAATATTTGTCTTTTTAGAGACTACAAATGGACTACCACACACGGATGTATATAGACATATTTTAGAGTGTAGATTCACTTATTTTGCTCCGTATGTAGTCACTTTTTGAAATCTCTAGAAAGACAAATATTTAGGAACGGAGGGAGTATATAGTTTCACTAGCTAGAACTCGTCCCTCCTTTGTATTAATCCCAGCTGTAGCTATGCTTTCCTGCGGAATGTGTCAACCAGAAAAGGTAACAGAATATACTTATGGACAAACATAGTTCAACTACATGTTAGCCACCAACCTACATCATGGTGACGGTAATCCTAAATTTTGTTCTGATTTTCAAAGGCATAATATTGAAGGATAATGACTTGACTTGAACAAACTGCTTTTCTAGTTGGTATTTTGTATTCACAAACATAGCAGCAATGCCTCTTATAATGTTTAGAAGCTTCAAAAATATGCTACTCATGCCTAATATTATTCGATTATGTGTGCAGCTATCACAAGAATATTAATCTTTAGGACAATTATTCTAGCATGTACTACTATCTTGGTCAACAGACTTGGTTGAGGACGTGCGCCAGTTTTCATTAATAAACCATCCAATGAGAACATTTATCTTAAGCTTTTGTTTTCTTCTATATGATTTTCCATTTTTCCATATAACTTCATGCTCCATAAGTTTTCCAAAAGAACATTATCACTTCACAATTTTTGGCAGTTTACCTTAATACTTTCATATTCTCTAAGAGCTTGGTTTTTCACTCCTTCTC
Type
EST
SNP
Sequence
NSFT03P2_Contig5405
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01