Query (optional)   in Class  

GrainGenes Probe Report: BE517805-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE517805-1B
Data at Wheat_SNP
BE517805-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>T;T>C;C>T;C>T;DEL;DEL;C>A;A>G;INS;T>G;C>T;A>G;G>A;C>T;G>A;C>G;T>C;G>T;T>C;G>A;A>G;A>G;T>A;T>C;G>A;C>T;C>T;C>T at 46;51;73;86;103;129-157;191-292;305;312;323,1;332;336;341;345;348;448;450;490;492;506;536;544;559;564;572;574;589;609;612
SNP A>T;G>T at 417;503
SNP G>A;T>C;G>T;T>C;G>A;A>G;A>G;T>A;T>C;G>A;C>T;C>T;C>T at 448;490;492;506;536;544;559;564;572;574;589;609;612
Reference sequence TAGCAAATGGTCCGAATATGAGACCTGCCAATTCATATCAGAGAGGTTATTTTTGTTCAACGACGCTGTTGCACTTCCTGCCACACATTTCATTGTCAAAATAGTGCAATATATTCATACCTGGTTTACAACAAATCCTTTCAGCATCTCAATAAGATCCCGACGCCTATCCGTGTCAAATCTTTTAATTTCAGTCATGTTATTTTCCTGCATTCAATAGAGAAGGTAAATGGCGGAGGGGCGAAATTATATAATTCTTATGGATGCGGTATGGTTCCAAAATTCAGTAACACACACTCCCAAGATTCCCAGAGGCCTACAAAAATTGATGTGCCAACTCCACACAAGAAATCAACCTCCACCCATTTTCTAACTCAAAAAATGATCCTGCAGTTTGTACCATTGTCCACATACCCAGAAAATACATGTTGAAACTCCAAAAAAGACGCATATTTGTAATGATCCACTCCCAGTATCTTAGCACAAAGACAAAGACCACCCTGTGGGATCTCTTAATAGCAAAGCAATATGTTATCATAGAAAGCCTAGTATGCATACATAATCTACCTGATCAGCCATTTAATTTTGGGAAACTCTTACAAAATTGAAGACATTTTTTTTGCAGCAGCAGCAGCAATAGCTCAACTAACACATTATATGCGGATTATCATGTATAGTTTCACTAGCTAGAACTCGTCCCTCCTTTGAATTTATATCCCAGCTGTAGCTATGCTTTCCTGCGGAGTGTGTCAACCAGAAAAGGTAACAGAATATACTTATGAACAAACAAAGTTTCACTACATGTTAGCCACCAACCCACATCATGGTGACGGAAATCCTAAATTTATTCTGATTTTCAAAGACATAATATTGATGGATAATGACTTGACTTGAACAAACTGTTTTTCTAGTTGGTATTTTGTATTCACAAACATAGCAGCAATGCCTCTTATAATGTTTACAAGCTTCAAAAATATGCTACTCATGCCTAATATTATTCGATTGTGTGTGCAGCTGTCACAAGAATATCATCTTTAGGACAATTATGCTAGCATGTACTACTATCTTGGTCAACAGACTTGGTTGAGGACGTGCAGTTAAAGAAATTAGAAACTATAACTGTGCGCCAGTTTTCATTAATAAACCATCCAATGAGAACATTTTTCAAACTTTTATTTTCTTCTATATGATTTTCCATTTTTTTCATATAACTTCATGCTCCATAAGTTTTCCAAAAGAACAATATCACTCCACAATTTTGGCAATTTACCTTAATACTTTCATATTCTCTAAGAGCTTGGTTTTTCACTCCTTCTCTTGTGC
Reference sequence AGATATTGTTCTTTTGGAAAACTTATGGAGCATGAAGTTATATGGGAAAACGGAAAATCATATAGAAGAAAATAAAAGCTTAAGACAAATGTTCTCATTGGACGGTTTATTAATGAAAACTGGCGCACAGTTATAGTTTCTAGTTTCTTTAACTGCACGTCCTCAACCAAGTCTGTTGACCAAGATAGTACTCCCTCCGTTTGTTTTTATAAGACGTTTTAGACAGCTAGCTTTGAACTGTTTTGGGCACTGTCTGAACTTTCTAAAACGTCTTATAAAAGTGAACAGAGGGAGTACATGCTAGCATAATTATCCTAAAGATTATATTCTTTTGACAGCTACACGCACAATCGAATAATATTAGGCATGAGTAGCATATTTTTGAAGCTTCTAAACATTATAAGAGGCATTGCTGCTATGTTTGTGAATACAAAATACCAACTAGAAGACCAGTTTGTTCAAGTCAAGTCATTATCCTTCAATATTATGTCGTTGAAAATCAGAATAAAATTTAGGATTACCGTCACCATGATGTGGGTTGGTAGCTAACATGTAGTTAAACTTTGTTTGTTCGTAAGTATATTCTGTCACCTTTTCTGGTTGACACACTCCGCAGGAAAGCATAGCTA
Type
EST
SNP
PCR primers
BE517805_cpF1 AGTTGCTCCTGTTCGCGTAT
Sequence
NSFT03P2_Contig5405
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01