Query (optional)   in Class  

GrainGenes Probe Report: BE517805-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE517805-1D
Data at Wheat_SNP
BE517805-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;INS;T>C;INS;A>T;A>G;A>T at 40;121,1;521;537,2;560;562;576
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE517805_cpF1 AGTTGCTCCTGTTCGCGTAT
BE517805_cpR1 CAAGAGGTATTGGGCAGGAA
Sequence
NSFT03P2_Contig5405
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01