Query (optional)   in Class  

GrainGenes Probe Report: BE517872-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE517872-2A
Data at Wheat_SNP
BE517872-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;DEL;T>G;A>C;G>A;A>C;G>A;G>A;A>G;A>G;DEL;G>A;INS;G>C;G>A;A>G;DEL;G>C;C>T;G>A;C>T at 10;278;291;331;332;337;352;364;392;407;433-434;440;457,1;485;504;554;557;563;565;586;598
Reference sequence CTGTATCTGATAAATGAAATGAAATATTGTTAATAGTTTCTCAAAAGACACACGACACAATTGCTTTCTGTGAAACCACTATACCAATATAAATTGCTTTGCCGCCAAGGCCACCATAGTCCACGGGAATTTGTACGTTGATTGCTAGCTGAATCCTACAAAAGCTGGCACTTAGTATGGTAATTTTCTTCTGAAATTGCATTGGATCAATAGTAGGTGCACATACCCCAGTTGAGTTTTACCAATTCCTGGAACCCCACCTGAATAAATCTAGTAGATTGATTAGTCTATTCACCACAGATACATCAACGGGCATACTGTTTTACATAAAGAACTAAACAGAGAAAAATGGAAGCCCTTATGGGATGTTCATGCACAAGTGATAAAAAGAATAGAACAAAGACTCACTAACTTCATCCTGCAAAAGAAAAAAAGACTCGCTAACTTCATACAATTATCACAACAGTAGAATAAGTTAACAGCAGTATTGCTAGAAGACAGGAGACCAAGAAACAAGCTATAGAAACAGAGCTAAAGGATAAACAGACTAAAAATTTGCCCAGTCGATTATATGGTTAACCAAGAGGTCCAATGCATCCCTTCAGCAAGAAAG
Type
EST
SNP
Sequence
NSFT03P2_Contig5603
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01