Query (optional)   in Class  

GrainGenes Probe Report: BE517987-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE517987-2B
Data at Wheat_SNP
BE517987-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;G>C;C>G;T>C;A>C;G>C;T>G;A>C;G>C;G>A;A>C;G>C;C>T;C>T;C>A;A>C;A>C;T>C;C>A;C>A at 27;29;36;44;46;64;89;137;257;259;267;270;285;288;297;312;335;351;381;388
Reference sequence CCCAACTACGCCAAGTGCAAGACCCGAGGCGAGCTCGACGGCGTCATGGAGATGGTGACCAAGGGCAAGAAGAAGTGCTGGCCGGAGATCTGCAACAGCGAGCGCCTCAAGCTCTGGGAGATCAAGGACCTGGTGAAGGAGCTGGACGCCAACTGGCCGACGCTGGCGTGCAAGAGCGGGAAGAGCATCGAGTTCTGGACCCACGAGTGGGAGAAGCACGGCACCTGCTCCAACCTGGACCAGCACGGCTACTTCGGGGCGGCGCTAGGGTTCAAGGCCCGCCACAACCTCACCGGCATCCTTGCCGACGCAGGGATCGTGCCGTCGGACAATAAGACCTACTTCCTCAGTAGCATCAGGGACGCCATCAAGGATGGGACCGGGTTCCC
Type
EST
SNP
Sequence
NSFT03P2_Contig16711
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01