Query (optional)   in Class  

GrainGenes Probe Report: BE518379-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE518379-6D
Data at Wheat_SNP
BE518379-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;G>C;DEL;C>A;T>G at 116;162;435-438;454;503
SNP C>T at 378
SNP G>A;G>C;T>G at 28;162;503
SNP G>C;DEL;C>A;T>G at 162;435-438;454;503
Reference sequence GGCTACGACGGGGAGGCGCCGCTCTTCGCGCGCTTCAACCTCCGCGTCGCCCCCGGCTCGCGCTGCCTCCTCGTCGGCGCCAACGGATCCGGTAAGCACCCGACCCCTGGCGCCTACCACGACCCGCGAAATTTACTTTGCTGCTGCTCCTGTGATCCGGAGGACGCGAGGGGCGCCTTGTGGCTTGCCTAGCTGCCGAATGATTTAGGCACAAAAATAAACTGGCCTGTAATTTGGTTCTTGCCTCAAGAAGTCAGGATAGCTGTGTGGTGGGGGGTTTCCTGTGCTCTGTCTCTCTGTTTTGAATTAAATGTTGCTGTTTTGAATTAAACGACCCGCGAAATCTACTTTGCTGCTGCTCCTGTGCGGTGATTGTACGATTCGGACGGGTCCTTCTGCTGGGCTTTCCTACTAGCTGCAGGCTGATTTAGGCACAGAGTGTTTAGGGGTTTGCTTGATTTGAGACCCCATCAACGTGCTACATGTTGTTTTATCTGTGTTTTCTTGGGACTGGGCTAGAAATTAACTGGTCTGTAATTTGGTTGTTGCCTCAAGAAGTCAGGATTGCTGTGTGGTGGCCTGGTGGGGGG
Type
EST
SNP
PCR primers
BE518379_cpF1_UCD AGGTGAGCACCCTGCAGTT
BE518379D_R1_UCD CAGAGAGATGAGCACACGAACC
Sequence
NSFT03P2_Contig2714
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01