Query (optional)   in Class  

GrainGenes Probe Report: BE518440-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE518440-2A
Data at Wheat_SNP
BE518440-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;INS;T>G at 155,2;155,2;187
Reference sequence CATTGCTATTAGCATAATGTATGCAGTGTCATAAGCTTACATGCTGAACATAGAAGCCAATCCAATTTTTTACTTAAATAAATCAATTCCATATTCATATGTACATATATCCCATAAGCATAAACGATAAATCCTCGTCGGTAAGTTGATACAGACCAGAAACGGAGAACACGATAAATATGAAAATTAGTCTCCTATAGCTTATTTATGCAACTGAAAGTATCAAACAACACTTACATTATCAAGCAACTCTAGAATCTGCAGTTGGGCATTA
Type
EST
SNP
PCR primers
BE518440A_F3 GCATTGCTATTAGCATAATGTATGCAG
BE518440_cpR1 AATGCCCAACTGCAGATTCTA
Sequence
NSFT03P2_Contig10067
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01