Query (optional)   in Class  

GrainGenes Probe Report: BE518440-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE518440-2D
Data at Wheat_SNP
BE518440-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 218
[ Show all 8 ]
Type
EST
SNP
PCR primers
BE518440D_R1 ttgcataaataagctataggagactagBE442655-2D
PCR_primers
BE518440_cpF1 GGCAAACTACAACTGCACCA
BE518440D_R1 aatgtaagtgttgtttgatactttcag
Sequence
NSFT03P2_Contig10067
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01