Query (optional)   in Class  

GrainGenes Probe Report: BE585760-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE585760-2A
Data at Wheat_SNP
BE585760-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 149
SNP G>A;G>A at 184;481
SNP G>A at 481
Reference sequence AGCATCGACATTCTGAAGCTCATGTCCTCTACATTTTTGGTTGCGCTGTGCCAAGCCATCGACCTGCGCCACCTCGAGGAGAATGTCAAGAACGCCGTCAAGAATTGTGTCACAAGAGTGGCCAGGAAGACCCTGATCACAAATGACATGGGTGGCCTCCACAACGCACGTTTTTGTGAGAAGGACCTGCTCCAAACAATTGACCGCGAGGCGGTGTTTGCATACGCGGACGACCCTTGCAGCGCCAACTACCCTCTCATGAAGAAGATGCGCGCGGTGCTGGTGGAGCACGCCCTGGCCAACGGTGAGGCTGAGCGCAATGTGGAGACCTCGGTGTTTGCCAAGGTTGCCAAATTTGAGCAGGAGCTCTGCGCGACACTGCCTCAGGAGGTTGAGGCTGCTAGAGGTGCAGTGGAGAATGGCACTGCTGCAGAACCGAACCGTATCACTGACTGCCGATCATACCCACTGTACCGGTTCGTGCGCGAGGAGCTGGGAACGGTGTACTTGACCGGAGAGAAGACGCGGTCACCTGGGGAGGAGGTGGACAAGGTGTTTCG
Type
EST
SNP
PCR primers
BE585760A_F2 CTCCCTCGGATTAATCTAGG
BE585760_cpR1 ACGAACACCTTGTCCACCTC
Sequence
NSFT03P2_Contig17813
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01