Query (optional)   in Class  

GrainGenes Probe Report: BE590469-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE590469-7D
Data at Wheat_SNP
BE590469-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;C>T;T>C;T>C;T>C;T>C;A>C;INS;A>T at 36;84;102;260;675;678;680;860,1;951
SNP T>C;A>T at 72;763
Reference sequence CTGCGGCACAGAATTCTTCGAAATCCATACTCCTGTATGCAAGTGGTTCCAACTGAGAGAAACAAAAACGAGGTCAGCAACTTCGACTACTAATTACACAATGTTATAACAGGAAAACAAAAACAAAACAAAATAAAATTTGGAAAAGAAGCTCAAACAGAAACAACTACATCAGGTATCAACGCATGGCTTTCAACATTGTATTAAAAAAAGGAATTTGTCCAGTAATATGAATAGTAAAACAGATATGTTGACTGGGTGGTTGCATAATTCATGCTATCCAGCAAAATTAATCAAAGTATGACTAGAATTATGGTTAACAATATTAAAAAGGCAAACTGTGTCTACATGTGTAAGATTTCAAAGGGAAACCATTAATTGACACCAACTCAGACAGGATGATCAAGAACTCCCCTTGCTGTCAAACTCCAAAATACAGTACATAACTTTTTTTCTGCGATATAATATAATACAGTGCATAACTAGATAAGAAGGTAATGAATTCAAATGCGGTATAAACTAAATTAACCCTCTACAGAAGCACCAATTATGTTAGTTGGACAACTGTGTTCTATGATAATTTGGCATGTCTTAATTCAAAGTTTTCAACACAGGCACCAGATTATTATGATATTAGTAGCAGCGCCAAAGTAACCAAAGAGGAAACCATCCATTGCTTAAGGCCAGTAAATAAAGACCCTTACCGCATGCAAAAACTCAAGAATTCTTGATTCCTTCATTGCATCAGTTAGATACCGCGTTAAAGCCTGGATAGGACCATGAAACACTATGATTAAAAGGTTGTAATAAGTATACATGGAGATAGTTTATCATGTCATTTCATCAGACGCCAATATAAATTATCCACATTTCTTCATCCTTATTAAACACATCCACTCATGGTATTTACAAGCACCAAGAAAGTTTTCTTAGAATTGAACTCTGAATGAAAATTTCTATTACGACATGTAAATAAGTGCAAAACATCGCACTGAAGTACTCAGATAAAAATCTAGCACCACCATCACTCATGTATCACTAAACCATATTGTTACAGTGATGGTAAACGATTGCAATGTTTGAATTTCAAATGTGTAAATGTCTGACAAAA
Reference sequence GGCTTTCACATTGTATTAAAAAAAGGAATTTGTCCAGTAATATGAATAGTAAAACAGATATGTTGACTGGGTGGTTGCATAATTCATGCTATCCAGCAAAATTAATCAAAGTATGACTAGAATTATGGTTAACAATATTAAAAAGGCAAACTGTGTCTACATGTGTAAGATTTCAAAGGGAAACCATTAATTGACACCAACTCAGACAGGATGATCAAGAACTCCCCTTGCTGTCAAACTCCAAAATACAGTACATAACTTTTTTTCTGCGATATAATATAATACAGTGCATAACTAGATAAGAAGGTAATGAATTCAAATGCGGTATAAACTAAATTAACCCTCTACAGAAGCACCAATTATGTTAGTTGGACAACTGTGTTCTATGATAATTTGGCATGTCTTAATTCAAAGTTTTCAACACAGGCACCAGATTATTATGATATTAGTAGCAGCGCCAAAGTAACCAAAGAGGAAACCATCCATTGCTTAAGGCCAGTAAATAAAGACCCTTACCGCATGCAAAAACTCAAGAATTCTTGATTCCTTCATTGCATCAGTTAGATACCGCGTTAAAGCCTGGATAGGACCATGAAACACTATGATTAAAAGGTTGTAATAAGTATACATGGAGATAGTTTATCATGTCATTTCATCAGACGCCAATATAAATTATCCACATTTCTTCATCCTTATTAAACACATCCACTCATGGTATTTACAAGCACCAAGAAAGTTTTCTTAGAATTGAACTCTGAATGAAAATTTCTATTACGACATGTAAATAAGTGCAAAACATCGCACTGAAGTACTCAGATAAAAATCTAGCACCACCATCACTCATGTATCACTAAACCATATTGTTACAGTGATGGTAAACGATTGCAATGTTTGAATTTCAAATGTGTAAA
Type
EST
SNP
PCR primers
BE590469_cpR1 ACTTGACAACTTTCGGACGG
BE590469D_F2 TAAAATTTGGAAAAGAAGCTCAAA
Sequence
NSFT03P2_Contig6234
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01