Query (optional)   in Class  

GrainGenes Probe Report: BE590745-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE590745-4B
Data at Wheat_SNP
BE590745-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 11,1
SNP G>A;DEL;G>A;DEL;INS;G>A;A>T;DEL;G>T;T>C;T>C;C>T;G>A;G>T at 93;99;110;129-132;140,3;141;152;166-167;171;214;226;242;398;492
Reference sequence TAATCTGATCAGCACGGTGACAAGATCTTGGATGAAGCAAACAAGGTCTTCTTGGGACACAGAGTGCAACTGGCAATCAAAGTAAGTGCTCCCACCCTAAAGATCTCAGTTTGTTACAAAAAAAGTTGAGAAGTCATGTATGATAAACAACAAAAAAAAGTACACAAAAATTCATTCTAACACTCTATAGGCTAAAGGAACTTGCATTTCTAAATCTAGAATGTAAATGAGACATGGTCCAATGTTTGGTTGCAGATCTCTGGCATTCACTGGTGGTACAAGGCTCCAAGCCATGCGGCCGAGCTCACAGCTGGGTACTACAACTTACATGACAGAGACGGCTACAGACCCATAGCACGCATGCTCAAAAGGCACCATGCTAGCCTTAACTTCACTTGCGCCGAGATGAGGGACTCGGAGCAAAGCTCGCAGGCGAGGAGCGCACCAGAAGAACTAGTCCAACAGGTAGGTAACATATGCCTTTGGATATTACACTTATATATCTCTAATTGAAACACCTAAAGCACTTGTCGTCGAAATTCTCAGGTGTTGAGTGCTGG
Reference sequence CAAGATCTTGGATGAAGCAAACAAGGTCTTCTTGGGACACAGAGTGCAACTGGCAATCAAAGTAAGTGCTCCCACCCTAAAGATCTCAGTTTGTTACAGAAAAAAGTTGGGAAGTCATGTATGATAAACAACAAACAAAAGTACACAAAAAATCATTCTAACACTCTATAGGCTAAAGGAACTTGCATTTCTAAATCTAGAATGTAAATGAGATATGGTCCAATGTTTGGTTGCAGATCTCCGGCATTCACTGGTGGTACAAGGCTCCAAGCCATGCGGCCGAGCTCACAGCTGGGTACTACAACTTACATGACAGAGACGGCTACAGACCCATAGCACGCATGCTCAAAAGGCACCATGCTAGCCTTAACTTCACTTGCGCCGAGATGAGGGACTCGGAGCAAAGCTCGCAGGCGAGGAGCGCACCAGAAGAACTAGTCCAACAGGTAGGTAACATATGCCTTTGGATATTACACTTATATATCTCTAATGGAAACACCTAAAGCACTTGTCGTCGAAATTCTCAGGTGTTGAGTGCTGGTG
Type
EST
SNP
PCR primers
BE590745B_F2 CACGGTGACAAGATCTTGGAT
BE590745_cpR1 CCTCTCTCCAACCAGCACTC
Sequence
NSFT03P2_Contig18732
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01