Query (optional)   in Class  

GrainGenes Probe Report: BE591000-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591000-4D
Data at Wheat_SNP
BE591000-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 86
SNP A>C;T>C at 34;86
SNP C>G;A>C;T>C at 95;165;217
Reference sequence GTCTTCATTTACCAAGGGGTATTTCTTGAACAGGGACACTTTGGTCGGTGTACTGCTCCTTGTTGATGCTAGTGTTCCAACTCAACAAATTGACCTCGACTGTGCTAACTGGCTTGGTCGTAACAATGTGAGACAACTTACCCTTTCACCTGAAAATGTATATTACATGCTGGTTATGGATTTAAATGTCAAGTGACTTGTATCTTCAGGATTGATTGTACATGTGCCCTATAATAATACTGATCTCCAGCAACTATCTGCTATTCTATTGTTTTGGTGTCACAGGTCGGGCTAACCTTTGTGTTCACCAAGTGTGACAAAGTAAAGAAAGGCAAAGGGGGTCGGCCTGATGAGAACATCAAAGTGTTCCTGGAGAACATCGGTTCGCTCTATCCAAGGCCTCCTCCATGGATCATGACGAGCAGCACCACAGGACTAGGCCGCGACGGACTGCTCCTCCATATGTC
Reference sequence GACAACTTACCCTTTCACCTGAAAATGTATATTACATGCTGGTTATGGATTTAAATGTCAAGTGACTTGTATCTTCAGGATTGATTGTACATGTGCCCTATAATAATACTGATCTCCAGCAACTATCTGCTATTCTATTGTTTTGGTGTCACAGGTCGGGCTAACCTTTGTGTTCACCAAGTGTGACAAAGTAAAGAAAGGCAAAGGGGGTCGGCCTGATGAGAACATCAAAGTGTTCCTGGAGAACATCGGTTCGCTCTATCCAAGGCCTCCTCCATGGATCATGACGAGCAGCACCACAGGACTAGGCCGCGACGGACTGCTCCTC
Type
EST
SNP
PCR primers
BE591000_cpR1 GCGACATATGGAGGAGCAGT
BE591000D_F1 TTCCAACTCAACAAATTGACCTC
Sequence
NSFT03P2_Contig7967
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01