Query (optional)   in Class  

GrainGenes Probe Report: BE591222-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591222-3A
Data at Wheat_SNP
BE591222-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>C;A>C;A>C;T>G;A>C;A>C;G>C;A>G;A>T at 13;35;58;75;82;91;114;142;170
Reference sequence CTGCAGCACAACAATGAAAAAGGTATAATAAACAACGTTGATAGAAAAACAAGTGATAAGGACCTACAAGGTTTTATCTATAATAAAGAAAATGCTGAACTTACTTTGTCGAGGAAATACTGGAAGTAAGTAGGTGAAAGCAGGCTACCTAGCGCAGGAACGGTACTGGACAAAATAGAGCTGATACCATTCACGTACCTGGAATGGAACAATGTAAAACTTAGCTTCAAATAGAGTAGGGAAAAACTCAGTGAAACCACTTAGCAGTTATTTATAAAGTTGAATAAACTGAAGAATACAGCGTTCCAAACTTTCAATGAACTGATTTTTATGACAATAAATATGTAGTGCAAACATATTTGTGCTCGAGTGTGCTAGTTTTAGCATGAGCCATTGGTTGGACTATTTAGAAAAACCCGATGGGGCGATAACTTCGAATTTTAGGGGATTGCATGCAAATTCTGCATCCATGCTTCTGCCATGAGAGTTGGTGTATATGCATCTCTTACAAGTAACGGCATGCCGCTTCCCATAATACAGACCCCAATTGGCAGTTCATATCAATATCCTCTTCTTTTCAGTCAGAGAAAACCAACTACATCAGCTATGAGATATGTGACATCATTGCAATTTTATGGAACAGATACATTTTT
Type
EST
SNP
Sequence
NSFT03P2_Contig12974
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01