Query (optional)   in Class  

GrainGenes Probe Report: BE591258-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591258-3D
Data at Wheat_SNP
BE591258-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>C;T>G at 130;753;840
Reference sequence CGCAGGAGTATTAGATTTGACCTTTGTTCCTCGGATCAAGGTTGAATTAGCTCATCACTATGCATGTTTATTGTAAATTCAGTTATCCTGTTCATGATCAGATTAAGTAGACATGTGAAGTCTGAAAGAGTTATATATCTAAATTTCCTTTATCCTTTCTCTTTCTTCTAGTCCTCGTTCTTAAAAGTGAGCAAGTGTCAGGAGTCAAGTTCAAGTGTAGCACTTATCTTTATTATAGTAAACTTTGTTAGTCTTACTCTGAAGTGTTTGTAGATTCACAATCATTAATGAAGTGTGAGTTGTAGCTAACATGTACTTAGGATAAGATTGGTTTGATTATCGCCCAATGAACATGGGGAGTCTTACTTTTGGCTATAGTGCTTATTTTTCTGATTGTTAGGCATGTACATACATTTAGCATGTTTTCAGTACACTGGGGAAAGAAATGAATAGGACATAAAACAGCTATCTACTATTAATTGAGTCATTCCATTTTCAGTTGGTGCCTAGATGCCCTGGCAACTCACATCTGTGACCAGCTAGAATCTGTAAACCCAATTAATAGCAAAAAATAGGTTTTGATTTTGACAAACCTCGATGCTAGGAATTCTTGAGCTATGAAATGAATATATATGGTAGTTGTATCACTGCTTTAACAAGTTCTAATGTTTTGGATGCACTGAGGTTTACCTACTGTGAGCTGTCATTTATAGAAAGAAAAAGAGAGCTTTATGTTTTTATTGCTTTTCTCTATATATAGTTTCCAGTGCATGTCTATGCCCTCTTCTGTATGTTAGTTAACCTTGTTAGTGAGCAATGAGATAATGGAACCTAAATGCTGTCATCCTGTGCTGCCTACCTGCCTAAATGCCACCATCTGAATTTTATCTGCATTCCTGTGTCCAGATAATCTGTGGGCTCCTGATAGCACACCAAACATACCACTCCCAGTTTTTGGTTTGGCTTCCTACAAGTTTAGCAACTCAGTCTGGTCCTCAACTGATGGTGATTGGAAACTGGCTAGCTGCTTAAGGCAAGCTGCTGCCGACTGGCTGAGAGACAG
Type
EST
SNP
Sequence
NSFT03P2_Contig12171
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01