Query (optional)   in Class  

GrainGenes Probe Report: BE591290-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591290-1B
Data at Wheat_SNP
BE591290-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;C>T;G>C;A>G;A>G;G>A;T>C at 31;61;64;199;241;253;289
Reference sequence CCCCCTGACACACTTCCGGGAGGAGTTCCGGTTCTCGCAGTCTCTGCGGGGAATGCTCATCCGGCACCCTGACATGTTCTATGTGTCACTCAAGGGAGATAGGGACTCGGTGTTCCTCCGTGAGGCGTACAAGAACTCGCAGCTGATCGAGAAGAGCCATCTGGTGTTGCTTAAGGAGAAGATGAGGGCTCTTGTTGCAGTTCCACGCTTCCCTCGGCGTGGTGGGCCTAGGACTGGTGAAGAGACAGAGGGGCCCAATGGCGCTGCGCAAGGGTATAATGAAGGAAGTGACATGGAAGATGATGAAGACGATGATTTTTCGGACATGGAAGATTGAATTTGGGG
Type
EST
SNP
PCR primers
BE591290B_F1 TGGTTGACCACCTGACACAC
BE591290_cpR1 TTCCCCAATCAAATCTTCCA
Sequence
NSFT03P2_Contig11382
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01