Query (optional)   in Class  

GrainGenes Probe Report: BE591305-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591305-7B
Data at Wheat_SNP
BE591305-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 218
SNP C>T at 592
SNP T>C;G>T at 44;45
Reference sequence AACTACTCCCTCCGTCGCAGAAATGGATATAAATGGATGCATCTAAAACTAAAATACGTCTAGATACATCCATTCCCCCGACAAGTATTTCTGGACGGAGGGAGTACTTATTAGTGACAAGTCATAAATAAATTTGGTTCAGCAGACCCTACTGAACATTATATATACTTCATTCACTATGACTGGCCACAGTGGGAGTAACTTCAAGAGTAACATCAGGTCCAACTCAGCAAATTTGCCTATGTGACAATGAGTTAATGAGAGAGATAAATTGAGTAACTTAGCTAGTTATCGTAACATCACATATCCCAAGACAATATGAGTCTATAACCTAATAATGAAGCTTTGCATGACACTACACATATGTTCCTACCCACTATGAAGGTAGTAACATAGCCTAGGGTAGCGTGTATGTTACTAGTGTAAGTTACTCTCCACTATGTCTAGTCTAAAAAAGCAACAGAGTTAATTACCTCCTGAGTTGTCCAAGCACGTGGTCCAGCAAATGTTAGGAGTTTTTTGCTGGCCTTCTCGTTGCGCAAAGCAACAAATGTCAGGCGAGCGACGTCCTATAGTTGCACAGAGAAGGAGCGTCAACAGTAAGCTACTTTGGAGAGAGACTGGTACATAGATATACACAGTTTCATCTTCCAATGGAAAGGG
Reference sequence ATTGGCATCTTGCCCAGCCAGTCTCTCACATAATGTAATAACCTGGAGAAGGCAAAATAAATAGAATTAAAATAATAATGTACCAACTCCCATAAGCCATCATTTGGTACATTCTCAAAAGCAAAACAAAATGCATGAATGACTAGATTTGTACATTCCCTATGAAATAGTGTGTTATACTAACTAGTACTCCCTCCGTCCCAAAATTCTTGTCTTAAATTTGTCTAGATACGGATGTATCTAATACTAAAACGTGACTTGATACATTCGTATTTAGACAAATCTAAGACAAGAATTTTGGGACGGAGGGAGTACTTATTAGTGACAAGTCATAAATAAATTTGGTTCAGCAGACCCTACTGAACATTATATATACTTCATTCACTATGACTGGCCACAGTGGGAGTAACTTCAAGAGTAACATCGGGTCCAACTCAGCAAATTTGCCTATGTGACAATGAGTTAATGAGAGAGATAAATTGAGTAACTTAGCTAGTTATCGTAACATCACATATCCCAAGACAATATGAGTCTATAACCTAATAATGAAGCTTTGCATGACACTACACATATGTTCCTACCCACTATGAAGATAGTAACATAGCCTAGGGTAGCGTGTATGTTACTAGTGTAAGTTACTCTCCACTATGTCTAGTCTAAAAAAAGCAACAGAGTTAATTACCTCCTGAGTTGTCCAAGCACGTGGTCCAGCAAATGTTAGGAGTTTTTTGCTGGCCTTCTCATTGCGCAAAGCAACAAATGTCAGGCGAGCAACGTCCTATAGTTGCACAGAGAAGGCGCGTCAACATAAAGCTGCTTTGGAGAGAGACTAGTGCATAGACATACACAGTGTCATTTTCCAATGGAAAAGGAGAAAAGATAA
Type
EST
SNP
PCR primers
BE591305B_F1 AAAGCAAAACAAAATGCATGAATT
BE591305_cpR1 CAGTTTGGGGAACTGATGCT
BE591305_cpR1 GTCCACTGGAAGAACCGTGTBE352570-7B
PCR_primers
Sequence
NSFT03P2_Contig7500
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01