Query (optional)   in Class  

GrainGenes Probe Report: BE591739-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591739-4A
Data at Wheat_SNP
BE591739-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;G>A;G>T at 262;774;1038
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE591739A_F1 TTTTACACATGGATCTGAGTAAGCTA
BE591739_cpR1 GCAGAACCACCGTACTGGAT
Sequence
NSFT03P2_Contig13273
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01