Query (optional)   in Class  

GrainGenes Probe Report: BE591739-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591739-4D
Data at Wheat_SNP
BE591739-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C;C>T;C>T at 224;299;513;660
SNP C>T at 660
SNP C>T;C>T;C>T at 224;513;660
SNP C>T;T>C at 660;763
Reference sequence TCTGTTGGTTATGCGTGAAGTACGTACTGATGATATTAATCTACATGCCATCTGCAGGAAAGGCACCAATGTGCTTGGACTGTTAAACAAGGTAGCTTCAGATGTGTTGGAACTAACGGACCTCCTCCATTGCGAGATAACTATATCATCAAAACCTTTGGATGCTTCAAGGTAATTTGTATACCTATTTAGGAACTTACAATTGCTTAAGAACCGATAAGTTCGATTTAGCAAATCCATGAAATGAGCCCCTCCAGCAAATAAACTACAATATTTTCTTAATGTTTGACCATATATCTACATTGCTGTATAGATTTCACACAGAAGAAATCATACCGATGGTATTTGTATTAAAATAGTCTTTCATAGTATATATGTGGTCAGTTTTAGTTCACAACATGGGTAAACATCCGTATGAGAGGAGAACATGACCATGTGAAAGGAGAGCACTGATCTGCAGAGGAACAGATGTATAACAGCTGGCCAAATAAGAGATGATTGGCAGGGACTTGCTTATTAGAAGACTTTGCTATTCCATTGCTTAAACTCAAAGATAGCTGCCACACCCTTCCTATCGAATTGATTTTTACATGCATATCTAAAACAAATATGTACTCTAGTGCAGATAAAATGGAAACTACCAACCCAAAGGAAACAAGCCAACCTAATATGCAAGTAATGGACTTCCTGCTGGCTTGCTGGCAGTACTAATGGTTATCTTTTACATGTTTTGCAGTGGACAAGGGTCATGTGACATCAAAATCAATGATGATTTCTGCGCAGCTACGATGGTACCTCTTTTGCTACAGAAGGGTGTCCTCAGGACAAACTGCATAGACTGCTTAGACCGCACAAATGTCGCACAGTTTGCATACGGATTAGCTGCTTTAGGGCGTCAACTTCATGTGTTGAAGCTC
Type
EST
SNP
PCR primers
BE591739_cpR1 GCAGAACCACCGTACTGGAT
BE591739D_F1 ATCTGAGTAAGCTTTCTCGAAGGTATA
Sequence
NSFT03P2_Contig13273
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01