Query (optional)   in Class  

GrainGenes Probe Report: BE591861-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE591861-4A
Data at Wheat_SNP
BE591861-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 186
SNP T>A;T>C;G>A at 474;848;996
SNP G>A at 412
SNP C>T;T>A;T>C;G>A at 422;474;848;996
Reference sequence GTCTGCTGGGCACGATTATCCATATTCTAGTGGATATCATGCATCAGACGATGTGCTTCCTGTTGACCGTTATGCAAATTATGGCAGCTCCCAGGTATAGCATCCCTTTTATTCATTGCAAATCCTGCCGACATTTTGTCAGGTTTCTTATCCCACAATACGAACTGAAACCATCTCTAGGTCTACGGAGGCGGCTATGGTGCTTACAGTGGTGGTTCTGGCAGCAGCGGGTAAGAATGACTTTTTTTTAGTCACCCAGTATACATATTCACGTTGTTGATCATAGTTCTGTGTAGGGAAATAAATGTTAAAAAAAGCACTAAGTGTAAATTGCTAGTTCTGCCTCTAGCGCCTACTTTGCCTAAGCGGCATGCCTAGGGACGATTAAGCACATGGCTAGTACGATAAATCGGTTGCTGTTCTGCTGTCGCCTAGCACCTAATCACAATTAAGCGGCACATGTATAGGCGTGGTTTTTTTAACCAAAATATTAATGTTTCTTTACACTCGATATATTGCTGTCTATTACTCCCTCTGTCCCATTATACAAGATGTTATTAGAACCAATGTACTCATATGTTGGTTGTAATAACATCTTATATTATGAGATGGAGGGAGTGTCATTTTGTGCAAACTTTGGTCAAGGCCAAGTTTACTTGATATTCCATTTTTATCTTTGTAGGCTTATCTTTATTCCATATGTAATTTTTCACTTGGTACTGTTTGCAAATTCTTTATCAGGTTATCTGGCTCTACCTATCTTTCATCTGGAAAACGCTATGGCTATTAAAATGCAGGTTGTTGAATCCAACAGGTATGGTTGCTGTGCGTGTTGAGACGTATATAGTGACTACATGGTCAATACTTGCTTCTAACCACATCTGCCTTTGAAACACATTGAACCCAGCTCAGCTCTCTTCCGATGAACCTGTCCGTTTCACATTTGCACCCCTGCCCAATCCTTTACTGAAAACAGCCAAGACCAATGAAGTTTGGAGCCTGCTTATTGGAGCCCCTACCCAAACCAGATGACTGAGAGTATGGCCCAACCTGGAAGCTTTGCTTAAGAGGACCTGT
Type
EST
SNP
PCR primers
BE591861B_F1 CTTTGCCTGCTAGTGTGTCC
BE591861_cpR1 GCCCGGAGGAAAAGATAAAG
Sequence
NSFT03P2_Contig16220
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01