Query (optional)   in Class  

GrainGenes Probe Report: BE604170-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604170-2B
Data at Wheat_SNP
BE604170-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>G;A>C;A>T;G>C;T>C;A>C;T>A;T>A;INS;G>T;T>A;T>G;G>A;T>G;T>A;C>T at 19;121;125;179;289;290;299;303;306;311,2;316;319;399;400;402;405;487
Reference sequence TGAAAATATTTCTTCTAGCCACCTAAGTTAGGAACCTGATGTTCCTATCCTATACCTCTTTATTAAAATGTAAGCAGATCCTGATGTTCCTATCCTATACCTCTTTATTAAAATGTAAGCAGATAATAATCTGTCTTGCAAATTTGGGCCGAACATATGGCCCCAGGCACAGCTCTCAAAGTGAAATTACCCAAAGAATATGGTAAACTGTTTGTTTGGCCTACTAGATAGTGTTGTTTCTATGTTGTGGCTTTTGGCTATAGCATCAGCACTGGATGATTATCTCTCGTATGTTTCTAGAATAGTAACATGCTAGATTGAACTGTCTAGTGTATCTCACATGCAAAATGTCAACAGGCAGGAGTATTGTCGGGCGATGTGAGCGATATTGTGCTTCTTGATGTTACGCCACTGTCTCTTGGTTTGGAGACACTGGGTGGGGTGATGACCAAGATTATCCCAAGGAACACAACCCTCCCTACCTCCCAGTCAGAGGTCTTTTCAACGGCTGCTGATGGACA
Type
EST
SNP
Sequence
NSFT03P2_Contig17374
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01