Query (optional)   in Class  

GrainGenes Probe Report: BE604170-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604170-2D
Data at Wheat_SNP
BE604170-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;G>A at 185;238
SNP G>T;G>A;G>C at 168;221;500
Reference sequence ATTTCTTCATAGTCACCAAAGTTAGGAACCTGATGTTCCTATCCTATACCTCTTTATTAAAATGTAAGCAGATAATAATCTGTCTTGCAAAATTTGGGCCGAACATATGGCCCCAGACACAGCTCTCAAAGTGAAATTGCCAAAAGAATATGGTAAACTGTTTGTTTGGCCTACTAGATAGTGTTGTTGCTATGTTGTGGCTTTTGGCTATGGCATCAGCGCTGGCTGATTATCTCTCATATGTTTCTAGAATGGTAACATGCTAGATTGAACTGTCTGGTGTATCTCACATGCAAAATGTCAACAGGCAGGAGTATTGTCGGGTGATGTGAGCGATATTGTGCTTCTTGATGTTACGCCACTGTCTCTTGGTTTGGAGACACTGGGTGGGGTGATGACCAAGATTATCCCAAGGAATACAACCCTCCCTACCTCCAAGTCAGAGGTCTTTTCAACGGCTGCTGATGGACAGACTAGTGTGGAGATTAATGTTCTCCAAGGAGAAAGAGAGTTTGTTAGGGACAATAAATCCCTTGGTAGCTTC
Reference sequence GTGAGTTCATGAAAATCATTTCTTCATAGTCACCAAAGTTAGGAACCTGATGTTCCTATCCTATACCTCTTTATTAAAATGTAAGCAGATAATAATCTGTCTTGCAAAATTTGGGCCGAACATATGGCCCCAGACACAGCTCTCAAAGTGAAATTGCCAAAAGAATATGGTAAACTGTTTGTTTGGCCTACTAGATAGTGTTGTTGCTATGTTGTGGCTTTTGGCTATGGCATCAGCGCTGGCTGATTATCTCTCATATGTTTCTAGAATGGTAACATGCTAGATTGAACTGTCTGGTGTATCTCACATGCAAAATGTCAACAGGCAGGAGTATTGTCGGGTGATGTGAGCGATATTGTGCTTCTTGATGTTACGCCACTGTCTCTTGGTTTGGAGACACTGGGTGGGGTGATGACCAAGATTATCCCAAGGAATACAACCCTCCCTACCTCCAAGTCAGAGGTCTTTTCAACGGCTGCTGATGGACAGACTAGTGTGGAGATTAATGTTCTCCAAGGAGAAAGAGAGTTTGTTAGGGACAATAAATCCCTTGGTAGCTTCAGGCTG
Type
EST
SNP
Sequence
NSFT03P2_Contig17374
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01