Query (optional)   in Class  

GrainGenes Probe Report: BE604721-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604721-6A
Data at Wheat_SNP
BE604721-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>A at 26;29
SNP G>A at 276
Reference sequence TCTTTATGCTGCGTTAGCGGATTTGCAATCAACAGCTATCTGATTACTTAGTTTAAGATTATGCCATTATGTCATACTTAAAACTATGATTTACTTGAAGATTTTAAAATGGTGAAATAGGAATATTACAATGCACGATAATTCATGTCGGATCTTAAAACCGAAATAAAAGCTGGAGACATTTGAATGCTTGCCAATGTCTTGAAATGGAAGCTTAAATTGATCAGAGTTCATACTTCAGTTGTGTGGGGAGTTGCAACGATAATTCTAGATGGCTCAAATTGCATATGTTGCTTCAAGTCGATACTTGTAAATGCATATTAGTCATGCAATAAGCAAACAAGGAAAACAGGAGACTCAATTCACCTTCATGGACTGCGCAGTAATTTTTACTAATTGCTACCATCTGTTTTGTACCTATTTTTTTCCCGAGTAACTGGCAGGAGTGCTGCTGATTCATTAAGACGAAAAAAAACTCAATCAACAGGCACTAGCGCCTGTGGCATTTTTACTTTAGAAGAAACAACTGAGCATCACAGGGGGAGGCCAGGCTGAGATTCATGAACTGCACAGTAAATTTGAATTACTACCATCTGCTGTGCACTCCCTTTTCTTCTGAGTAATCTGCAGGAGCGTTACAATTCATCAAGATGAAA
Reference sequence AGATGCTGAAGATGCAGTAAAATATATTAGTGGCACAATGCTTGATGATCGCCCAATCCGTGTTGATTTTGATTGGGGCTTTGAAGAAGGCAGGCAATGGGGCCGTGGAAGGAGTGGTGGACAAGTATTATTGCGATCTTACTCTTTATATTCAACAGATATATAGGCCTTGTACCCTACTCATACTGATATTGTTTACTCCTTTCATAGGTCCGAGATGAGTACCGCACGGATTATGATCCTGATATCCTTTGATACTAAAATTGCCACTTACTGCAGTGATGTGAGAGCGCTAGCATACTCAGAAACCTACCATGCTATCTAAAAATCAACAATTTGCCTGTGCATCTGGACACTGTTGGTTGCTTTTTAGATGCTTATTTATATTTTTCTTATAGCTTCACTCTTGATTTGGTATGCCTTTACATGTTTCTCTTTTTCTTGAATATACCTTAATGA
Type
EST
SNP
PCR primers
BE604721A_R1_UCD ACCTCTTCGTTAGATTCATTAAGGTAT
BE604721_cpF1_UCD CTCCAGGGAAGATGCTGAAG
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01