Query (optional)   in Class  

GrainGenes Probe Report: BE604721-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604721-6D
Data at Wheat_SNP
BE604721-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T at 401
SNP T>C at 289
SNP G>A;C>T;A>G;A>G;A>T;T>A;A>T;DEL at 102;237;404;443;547;555;557;592
Reference sequence CCAGTTCTTTATACTGCGTTAGCGGATTTGGAAACAACAGCTATCTGATTACTTAGTTTAAGATGTTTTACTTGAAGTTTTGAAAATGGTGAAATAGGAATGTTACAATGCACGATAATTCATGTGGGATCTTAACATCGAAATAAAAGCTGGAGATATTTGAATGCTTGCCAATGTCTTGAAATGGAAGCTTAAATTGATCAGAGTTCATACTTCAGTTGTGTGGGGAGCTGCAACGATAATTCTAGATGGCTCACATTGCATATGTTGCTTCAAGTCGATACTTGTAAATGCGTATTAGTCATGCAATAAGCAAACAAGGAAAACGGGAAGACTCAATTCACATTCATGGACTGCACAGTAATTTTTAATTGCTACCATCTGTTTTATACTTTTTTTTCCCAAGTAACTGGCAGGAGTGGTGCCGATTCATTGAGACGAAAAAAACTCAATCAACAGGCACCAGCGTCTGTGGCATTTTTACTTAGAAGAAACAACTGACCACCACAAGGGGAGGCCACGCTGAGATTCATGAACTGCACAGTAAATTTGAATTACTACCATCTGCTGTGCACTCCCTTTTCTTTTGAGTAATCGGCAGGAGCGTTTA
Reference sequence ATGCTGAAGATGCAGTAAAATATATTAGTGGCACAATGCTTGATGATCGCCCAATCCGTGTTGATTTTGATTGGGGCTTTGAAGAAGGCAGACAATGGGGCCGTGGAAGGAGTGGTGGACAAGTATTATTGCGATCTTACTCTTTATATTCAACAGATATATAGGCCTTGTACCCTACTTATACTGATATTGCTAACTCCTTTCATAGGTCCGAGATGAGTACCGCACGGATTATGATCCTGATATCCTTTGATACTAAAATTGCCACTTACTGCAGTGATGTGAGAGTGCTAGCATACTCAGAAACCTACCACGCTATCTAAAAATCAACAATTTGCCTGTGCATCTGGACACTGTTGGTTGCTTTTTAGATGCTTATTTATATTTTTCTTATAGGTTCACTCTTCAATTGGTATGCC
Type
EST
SNP
PCR primers
BE604721_cpF1_UCD CTCCAGGGAAGATGCTGAAG
BE604721D_R1_UCD GAAACATGTAAAGGCATACCAATTG
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01