Query (optional)   in Class  

GrainGenes Probe Report: BE604885-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604885-3A
Data at Wheat_SNP
BE604885-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;DEL at 133;133
SNP DEL at 133
SNP A>G;DEL at 76;77
SNP C>T at 284
Reference sequence CGCCTTATGCTATTATTGTCGTTCAGACCATCATTCCACCCATCGAGTAATCCAGGCTATGGTGTACAACGTTATATTTTTAGTAATAGAGATTATGTACAGTGGCGGAGCCAGGAATGTTGAATAAGGGGGGCCAAGTGTTGTTTAGCTTTGTTGGGGAGGGCCAGCCCGTCAAATTACTCCATTTTAGCAGGAATTAATCACCTACTGACATGCACATTAGCTTGAATTCAAGGATGTTTGGGGGGGGGGGGGGGCAGGGCCCCTGCTGGCACCCTGTCTCCGCCACTGATTATGCAAGAGTATTTTTACATCATATTTATGGAACATATGTCAAAAAGTACTTAGTGTAAGTGATCATCTAAAAATCTATTTATCATCACCACCATGTATATCTAGAAA
Type
EST
SNP
PCR primers
BE604885A_R2 GGTCATGACACAAAGGCAC
BE604885_cpF1 tgagtgtaacctgttttgcatagat
Sequence
WHE1713-1716_L20_L20ZS
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01