Query (optional)   in Class  

GrainGenes Probe Report: BE604885-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE604885-3D
Data at Wheat_SNP
BE604885-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;C>T;A>T;DEL;A>G at 142;143;184;257;363
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE604885_cpF1 tgagtgtaacctgttttgcatagat
BE604885D_R1 ACACAAAGGTATATCGATCCACTC
Sequence
WHE1713-1716_L20_L20ZS
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01