Query (optional)   in Class  

GrainGenes Probe Report: BE606403-5A

Probe
BE606403-5A
Data at Wheat_SNP
BE606403-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 402
SNP C>A at 374
Reference sequence GGTCACTGTTCAGGGTGAAGTTATCGAGCAGAGCTTTGGGGAAGAACACTTGTGCTTCAGGACGCTCCAGCGTTTCACAGCTGCTACTCTTGAGCATGGGATGCGTCCACCCATTTCACCAAAGCCAGAGTGGCGAGCTCTTCTCGATGAGATGGCTGTGGTGGCAACTGAAGAATATCGGTCAATTGTCTTCCAAGAACCACGCTTCGTCGAGTATTTCCGCCTTGTAAGTCCTTGCTCTCATTGACCATCAGGCTAGGAAACATATTAACTGCTTGAATAGACTTTTCAATATGTTGCAAACCTGAACCTGCCAGTGAGATGGAATTCATGCAATGATTTACGGTGGAAACCTATATCATGAAAATAATTTCAAAAAATAATGAATTGTGATAGCACTTAGGGTACCTTCTTTTGCAACTGTAATTTCTATGACAGTACAAACCCTCGCCAATGTTATATTGGCAGCTCAGGTTATTGCAGTAAGGTTTAAACAAAACAAAAACAAACCTTGGTGCCATTCAGGTTGAACCTTCAGTCAAATAATTTCTTTCTGATATTTGTGTTTGACAGGCAACACCGGAGACAGAGTATGGCAGGATGAATATAGGGAACAGGCC
Type
EST
SNP
PCR primers
BE606403A_R1 TTCTCTTGGATGGCCTGTTC
BE606403_cpF1 ATCACTCCGGGTCACTGTTC
Sequence
NSFT03P2_Contig16551
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01