Query (optional)   in Class  

GrainGenes Probe Report: BE637255-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637255-4A
Data at Wheat_SNP
BE637255-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 422-430
SNP A>G;A>G at 10;11
SNP T>C at 118
Reference sequence TCCCAAGGGAAAATGGAGAAATCATTCTTAAGGTAAATTATACTTTCAAGTACTTCACATGCTTCTTACTAGCTTGGTGTACTTAAAAATGGTGTATTTATGGAGTTATTTTCTTGGAAGTATGTATTTCCTCTGGAGTCCCATTCTCAGAAGATGTTGATCCTTTTAAAAAATAACAATCTGTCTAAATTGTGCAAAATATGGAAAATGTTAGCTAACTTGTTAAAACAGTGTGTATTTTCAACACTTAGTTCGGCAATTCAATATAGCAGAGAGTCCTTTTCTTCTAAGACATGATATACTAATTTTTAATCTTGTATATCTTGCAACTATGTTATCATTCTGTTAGTATTACCCCCCAAAAAACGGTGTTATTTTGTTAGTGTTACCTTGTGGTTGTAGTGGGACAATGCAGAGGTATAGATAGCACTGATCCTGTGATTTTCGAAGCCAGCATCATCCATTTTCCTAACTAGGCCACCATTCACACTGACACACATTAACACCAACAGAAACAACAAGATTGAAGTCTAACAGTATATC
Reference sequence TGATGCACCTAAAAACCTGAGGAGCTCCCAAGGGAAAATGGAGAAATCATTCTTAAGGTAAATTATACTTTCAAGTACTTCACATGCTTCTTACTAGCTTGGTGTACTTAAAAATGGTGTATTTATGGAGTTATTTTCTTGGAAGTATGTATTTCCTCTGGAGTCCCATTCTCAGAAGATGTTGATCCTTTTAAAAAATAACAATCTGTCTAAATTGTGCAAAATATGGAAAATGTTAGCTAACTTGTTAAAACAGTGTGTATTTTCAACACTTAGTTCGGCAATTCAATATAGCAGAGAGTCCTTTTCTTCTAAGACATGATATACTAATTTTTAATCTTGTATATCTTGCAACTATGTTATCATTCTGTTAGTATTACCCCCCAAAAAACGGTGTTATTTTGTTAGTGTTACCTTGTGGTTGTAGTGGGACAATGCAGAGGTATAGATAGCACTGATCCTGTGATTTTCGAAGCCAGCATCATCCATTTTCCTAACTAGGCCACCATTCACACTGACACACATTAACACCAACAGAAACAACAAGATTGAAGTCTAACAGTATATCATGATTG
Type
EST
SNP
PCR primers
BE637255A_R1 TGAAAACTGCAAACAATCATGAT
BE637255_cpF1 TGGTTCTCCATTTGATGCAC
Sequence
unknown
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01