Query (optional)   in Class  

GrainGenes Probe Report: BE637808-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637808-4A
Data at Wheat_SNP
BE637808-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 332
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE637808A_F1 CGCAGGTGAGCAGGAATG
BE637808_cpR1 TAGGAGTGTGACAAGCCGTG
Sequence
NSFT03P2_Contig7809
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01