Query (optional)   in Class  

GrainGenes Probe Report: BE637808-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637808-4B
Data at Wheat_SNP
BE637808-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;G>A at 461,1;631
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE637808B_F1 GGTATTCAGGGACATCCCGA
BE637808_cpR1 TAGGAGTGTGACAAGCCGTG
Sequence
NSFT03P2_Contig7809
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01