Query (optional)   in Class  

GrainGenes Probe Report: BE637864-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637864-1D
Data at Wheat_SNP
BE637864-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 127
SNP DEL at 15
SNP ND at ND
Reference sequence TTTCCTCATTTTGTAATCCTTCTCTCCCTGAATAACATTTTTGACCCTAATTTTGATGCACACTAGTTTTCCTTGAGAATTAATGTCATGTCTTCACTCTGTAGGTTTGTTTTCTTCCTGGCACCCTTGCTCTGGGTGCAACAAAGGGTATCACTAAGAAAAAGGCTCTTGAAAGTAATCTTCTAACTAAAGAAGACATAGAAAATCTTCAGCTTGCTGAAGATCTGGCTAAAACTTGTGTTGAAATGTACTTTGTGACTTCTACTGGACTTGCTCCTGAAATTGCTTATTTTCACATTGAGGTAAGCAATTCACTGAGCTATGGAGTATCTTGACGTACTCTTGAGCTATCCACATAACATTTTATTTTTCTTATATTTTAACATCGTATTTGTGTCTGGATGTTGCAGGGTAATCCTGAAGGTGGACCTGATGGTGGGAACAAA
Reference sequence CATCATGCATCTACCACTTCTTCTCTATAATGAGAATCTCCTCATTTTGTAATCCTTCTTTCCCTGAATAACATTTTTGACCCTAATTTTGATGCACACTAGTTTTCCTTGAGAATTAATGTCATGTCTTCACTCTGTAGGTTTGTTTTCTTCCTGGCACCCTTGCTCTGGGTGCAACAAAGGGTATCACTAAGAAAAAGGCTCTTGAAAGTAATCTTCTAACTAAAGAAGACATAGAAAATCTTCAGCTTGCTGAAGATCTGGCTAAAACTTGTGTTGAAATGTACTTTGTGACTTCTACTGGACTTGCTCCTGAAATTGCTTATTTTCACATTGAGGTAAGCAATTCACTGAGCTATGGAGTATCTTGACGTACTCTTGAGCTATCCACATAACATTTTATTTTTCTTATATTTTAACATCGTATTTGTGTCTGGATGTTGCAGGGTAATCCTGAAGGTGGACCTGAT
Type
EST
SNP
PCR primers
BE637864_cpR1 TTTTGTTCCCACCATCAGGT
BE637864D_F4 TCCTCATTTTGTAATCCTTCTCTC
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01