Query (optional)   in Class  

GrainGenes Probe Report: BE637911-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637911-6B
Data at Wheat_SNP
BE637911-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>A at 109;357
SNP C>A at 24
Reference sequence TGGATTGCTAATAGTCCTAGAAACACCAAACAGCGGTTGTGATTCAGGGGGTGGCTACGTCCAGGTCAATTCCGACTGGAAGTAGCAGTTGCACAACAAATCCTTTGATTGGTGATGCAGCTAAGTATCATCTTAGCCTACCAGGAAACCAGCATGGGAACTTGGGACAAGGTTTAGCAACATCGCTTGGGCAGGCCCAATTGCAACAGAAGTGGATGAATGAGGGCAGTGGCGATCTGTCCACCATCCTTTCTGGGAATAGCCGGGGTAATGGCATGCCTCGCATGCTCCCAAGTGTCACTAGCAGTCCATTACTACCTCCAGATCTCGTGGAGTGCACACAGGCCAAAGTAGCCATCCAGCCATCAGCTCGAGCTCCCTCTGCAAGTGTAGAACTTCTCGAAGGTGCCATTGGAGCCTCTTCTGGTCCATTGGAGTCTCGTGT
Reference sequence TTATCAAGCTTTCACCTCTCCTGCAGCGCTATCAACTTTCAGTGCACATGGATTGCTAAATAGTCCTAGAAACAACCAAACAGCGGTTGTGATTCAGGGGGTGGCTACTTCCAGGTCAATTCCGACTGGAAGTAGCAGTTGCACAACAAATCCTTTGATTGGTGATGCAGCTAAGTATCATCTTAGCCTACCAGGAAACCAGCATGGGAACTTGGGACAAGGTTTAGCAACATCGCTTGGGCAGGCCCAATTGCAACAGAAGTGGATGAATGAGGGCAGTGGTGATCTGTCCACCATCCTTTCTGGGAATAGCCGGGGTAATGGCATGCCTCGCATGCTCCCAAGTGTCACAAGCAGTCCATTACTACCTCCAGATCTCGTGGAGTGCACACAGGCCAAAGTAGCCATCCAGCCATCAGTTCGAGCTCCATCTGCAAGTGTAGAAATA
Type
EST
SNP
PCR primers
BE637911B_R1_UCD CCAATGGCACCTTCGAGTAT
BE637911_cpF1_UCD ATTCGAAGGACTCCAGGGTT
Sequence
NSFT03P2_Contig8940
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01