Query (optional)   in Class  

GrainGenes Probe Report: BE637911-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE637911-6D
Data at Wheat_SNP
BE637911-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;C>T;A>C;G>A;A>G;A>G;C>T at 34;40;78;244;262;277;477
Reference sequence ATTCGAAGGACTCCAGGGTTATCAAGCTTTCACCTCTCCCGCAGCGCTATCAACTTTCAGTGCACATGGATTGCTAAATAGTCCTAGAAACAACCAAACAGCGGTTGTGATTCAGGGGGTGGCCACTTCCAGGTCAATTCCGACTGGAAGTAGCAGTTGCACAACAAATCCTTTGATTGGTGATGCAGCTAAGTATCATCTTAGCCTACCAGGAAACCAGCATGGGAACTTGGGACAAGGTTTGGCGACATCTCTTGGGCAAGCCCAATTACAACAAAAGTGGATGAATGAGGGCAGCGGTGATCTGTCCACCATCCTTTCTGGGAATAGCCGGGCTAATGGCATGCCTCGCATGCTCCCAAGTGTCACAAGCAGTCCATTACTGCCTCCAGATCTTGTGGAGTGCACACAGGCCAAAGTAGCCATCCAGCCATCAGTTCGAGCTCCCTCTGCAAGTGTAGAACTTCTCGAAGGTGCCATTGGAGCCTCTTCTGGTCCATT
Type
EST
SNP
Sequence
NSFT03P2_Contig8940
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01