Query (optional)   in Class  

GrainGenes Probe Report: BE638039-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE638039-4D
Data at Wheat_SNP
BE638039-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C;G>T at 19;374;476
SNP A>G at 371
SNP C>A;A>G;G>A;DEL;G>A at 149;251;606;776;793
Reference sequence GTTGGGTGGAGTACATATATAGCCTGTGTTGACCGATGCCATCAGATGTTAATATTCTTCAAACATAAAATTAAAATTGCACAATGAGATCAAATGAGGTACCAACCTGAAGATTTCGCTGATGCTTACGACCTAGCATTTGTTGTAACCGCTTCATGAATCCCAAGTCTGGCTGTCTGTAAATTAAATTACAAAAACTTATATTACATCCAGTGCTTCTTATATGTTGCATGCGCTAAGGTTCAGACAGAGATGCAGTTTCCTTCCCAGCCTGCATATCCAACACTTACACTTGTAAGGACGCTGCTGAGTGGAAATAGACAATTGAGTAAGGCTTTTGAATCAAAGGTTCAAACTCCTGCAAACAAAGTATATCATGATACTGTCAGATTTTACTGTCCAAATGTTCCAAACCAAGATGAATGGATACTATGAAAAGAGGAAGTAGCAACAATCATATAAGTTAGAGAGAAGTTTGTAGATCTACTTCCATAGTCCAAGGTTGTTGCTACGTTAACTGCCAGATACATTGGCTAGAATTTCTTGCTGCAAGCCCACTCAATTTTGTCAAATTGCGTATATATAGGATTCCTTTATACACTCCCGGGAGTACTACATTCAGTACACCTTGTAAACAAATCTATGATACCGCTTTATCCTTCACGATATACTCCCTCCGTTCCTAAATATAAGTCCTTTTAGAGATTTCAATATGGACTACATACGGAGCAAAATGAGTGAATCTACACTCTAGAATATGTCTATATACATCCGTTATGTAGTCCCTAGTGGGATCTCTAAAAAGACTTATATTTAGGAACGGGAGGGAGTACTTCATTAATTATTC
Reference sequence TACTGAATGTAGTACTCCCGGGAGTGTATAAAGGAATCCTATATATACGCAATTTGACAAAATTGAGTGGGCTTGCAGCAAGAAATTCTAGCCAATGTATCTGGCAGTTAACGTAGCAACAACCTTGGACTATGGAAGTAGATCTACAAACTTCTCTCTAACTTATATGATTGTTGCTACTTCCTCTTTTCATAGTATCCATTCATCTTGGTTTGGAACATTTGGACAGTAAAATCTGACAGTATCATGATATACTTTGTTTGCAGGAGTTTGAACCTTTGATTCAAAAGCCTTACTCAATTGTCTATTTCCACTCAGCAGCGTCCTTACAAGTGTAAGTGTTGGATATGCAGGCTGGGAAGGAAACTGCATCTCTGTCTGAACCTTAGCGCATGCAACATATAAGAAGCACTGGATGTAATATAAGTTTTTGTAATTTAATTTACAGACAGCCAGACTTGGGATTCATGAAGCGGTTACAACAAATGCTAGGTCGTAAGCATCAGCGAAATCTTCAGGTTGGTACCTCATTTGATCTCATTGTGCAATTTTAATTTTATGTTTGAAGAATATTAACATCTGATGGCATCGGTCAACACAGGCTATATATGTACTCCACCCAACGCTG
Type
EST
SNP
PCR primers
BE638039_cpR1 CCATCAACAAGAAGCTGCAA
BE638039D_F1 TAGGAACGGAGGGAGTATATGGT
Sequence
NSFT03P2_Contig14132
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01