Query (optional)   in Class  

GrainGenes Probe Report: BF145580-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF145580-2A
Data at Wheat_SNP
BF145580-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 221
SNP G>A;T>C at 61;221
Reference sequence TGTGTGCGAACCTAGGGATCCTCTCAATCTCGACTATCTGAAAATTAGTGGCAAAAATTGGAAGAAATTTAAGAGCAGGAAGAAACTAACAAAAGATACAAGTTTGTTTTAGAGTAGGACATCACTCTTTACCTTCTTGGCAATGCTTCTGTCAAGACTCCAATCATCAAAGCAACCACCACCGAGTCCTGCAGGCCAACAGGAGCGGAACTTACTAAATTATCATGTGGAGAAGGTGATTAGACATTGACTTGAGAAGTAATAAAATTCTTGCTCAGAAAATACTAGTGCTTCTATGCTTTGCTAGTGCAAACCAGGCCATCTATAGCATTTATAAAAAATATGGAACCGTTCGCAAGTTCCTACTAAGATATTGGCATGAATTTATAACTGCGCTTTTGCATGAACAA
Type
EST
SNP
PCR primers
BF145580A_F2 TGTTCATGCAAAAGCGCAGTTATA
BF145580_cpR1 GTGTGTGCGAACCTAGGGAT
Sequence
NSFT03P2_Contig16617
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01