Query (optional)   in Class  

GrainGenes Probe Report: BF145580-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF145580-2D
Data at Wheat_SNP
BF145580-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>G;C>T;C>T at 240;279;301;345
SNP C>A;G>A;C>G;C>T;C>T at 63;332;371;393;437
Reference sequence TTATCAGGGTGGTCGAGATGAGCATGAATGATTCCTGGTTTCGTGACACCGGTCCCACTGTGCGTTAACTTGATTTTTCTTATATCCCTTTTTACCATCCTGATTTCATGGCTAACAGTATCCTCGTTTTTAGTTTATTACCCGTGAAGGCGGATCAGATATAGGACTTGCAGAGCAAACAATAGCGGGGATTGACTGGGAATTTAACGCATGGGGAGGTATGTTGTTTTATATTAAAGTATGTATACTTTTTTCAGTGCTTTCTCAGTGGCTATTTTTGTTCGTCTAGTTTAACTCTTTCTTTGATAATTATTTGTGTTCATGCAAAAGCGCAGTTACCAATTCATGACAATATCTTAGTAGGAAGTAGCAACTTGCGAACGTTTGCATATCTTTTACAAAAGCTATAGATGACCTGCTTTGCACCAGCAAAGCACAGAAGCACTAGTATTTTTTGAGCAAGAATTTCGTTACTTCTCAAGCCAATGTCTAATCACCCTCTCCACACGATGATTTAGTAAGTTCTGCTCCTGTTGTCCTACAGGGCTCGGTGGT
Reference sequence CCATCCTGATTTCATGGGCCAACAGCATCCTCGTTTTTAGTTTATTACCCGTGAAGGCGGATCAGATATAGGACTTGCAGAGCAAACAATAGCGGGGATTGACTGGGAATTTAACGCATGGGGAGGTATGTTGTTTTATATTAAAGTATGTATACTTTTTTCAGTGCTTTCTCAGTGGCTATTTTTGTTCGGTCTAGTTTAACTCTTTCTTTGATAATTATTTGTGTTCATGCAAAAGCGCAGTTACCAATTCATGACAATATCTTAGTAGGAAGTAGCAACTTGCGAACGTTTGCATATCTTTTACAAAAGCTATAGATGACCTGCTTTGCACCAGCAAAGCACAGAAGCACTAGTATTTTTTGAGCAAGAATTTCGTTACTTCTCAAGCCAATGTCTAATCACCCTCTCCACACGATGATTTAGTAAGTTCTGCTCCTGTTGTCCTACAGGGCTCGGTGGTGGTTGCTTTGATGATTGGAGTCTTGACAGAAGCATTGCCAAGAAGGTAAAGAGTGAATTCCTACTTTAGAACT
Type
EST
SNP
PCR primers
BF145580_cpF1 ATCAGGGTGGTCGAGATGAG
BF145580D_R1 CCACCACCGAGCCCTGT
Sequence
NSFT03P2_Contig16617
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01