Query (optional)   in Class  

GrainGenes Probe Report: BF200918-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF200918-2B
Data at Wheat_SNP
BF200918-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T at 41
Reference sequence TAAAACATAAGGAGATTATTGACTGAGTACATTCTGTCATACATCTTAGCCATAATATGAATTATCGCCAGATATTATAATGTAATAATTACCATTGGTGTAGTTGACAGTTCCAATTAATTGTGGCATGCTCTTTTTTCCTGCCAAAAGTTTGAATTGTAGAGCTAAAGTTGTTATTTGGAAAAATGTCAGCTTCTCAGTGTTAAAAGAGAGAAAAATAATTGATACATCCACGGATGAGGAGAATTTGGTTATAAAGCCTTGGTATTGGAAAAGAAATCGGA
Type
EST
SNP
PCR primers
BF200918B_F1 gtgattactagactagactcttgaattct
BF200918_cpR1 TAAGCACATTCGGTGAGTGC
Sequence
NSFT03P2_Contig11538
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01