Query (optional)   in Class  

GrainGenes Probe Report: BF201102-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201102-5A
Data at Wheat_SNP
BF201102-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>G at 333;441
SNP INS at 8,1
SNP T>C at 154
Reference sequence CTTCTCGATGGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCAAGTGGTTCGACACCAACTAGTAAGTCCACCGGATTCTACCTAAGGTTGTTCTCACATAGTTTATTCTGTATCTAGTACTTTTACTAACGACATCTTTTACTATTGCAGCCACTTTATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGGTATGATAGTAGAATCATATATTAGCTGACTTTCTATATCTTGTGAAATTTTACCCTTGTGACGTTAGCCTGCCTAATTGTTATTTTTGAACACGCAAGCATTGTGATGACACCCTGATCACTCTAGAATGCCCCTGTTTTAATCAAATCTCAAGTGATAGTAGTAATAAACTATTTCTTATTCCTACATTTGCTTAACTGTTTTGAACTAGTAAAAGAGTTGCAAGTTACATTAAGGTGCAGTTTTACATTGATATTTCAGAACATTCTCACTCTTGTCTGATCAAATTGGTTAATGGCCAACCAAGTAACTCTAATAATTACTTTATATAGTTGTAACATCTCATTACCATAGGTCCTGTGCTGAAAACTTTGAATGTAGAAAGTGTTGAATAGCAAAAATGAGATTGCAGTTACTAATTATATTTTCACTACAAACCCTGCAACGTGGTAATAGCGATGCTGGTAGGATTACATGGTTTAGCACCAGGTTGTCAATGTACCTGATTTGACAAGCTTTCAGCTACTAATTATCTGTTCATTATAATCCCTCCAATGTGGGAATAGTGATGCCGGTATG
Reference sequence ATTTGAGCCCTACTTCTCGATGGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCAAGTGGTTCGACACCAACTAGTAAGTCCACCGGATTCTACCTAAGGTTGTTCTCACATAGTTTATTCTGTATCTAGTACTTTTACTAACGACATCTTTTACTATTGCAGCCACTTTATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGGTATGATAGTAGAATCATATATTAGCTGACTTTCTATATCTTGTGAAATTTTACCCTTGTGACGTTAGCCTGCCTAATTGTTATTTTTGAACACGCAAGCATTGTGATGACACGATCACTCTAGAATGCCCCTGTTTTAATCAAATCTCAAGTGATAGTAGTAATAAACTATTTCTTATTCCTACATTTGCTTAACTGTTTTGAACTAGTAAAAGAGTTGCAAGTTACATTAAGGTGCAGTTTTACATTGATATTTCAGAACATTCTCACTCTTGTCTGATCAAATTGGTTAATGGCCAACCAAGTAACTCTAATAATTACTTTATATAGTTGTAACATCTCATTACCATAGGTCCTGTGCTGAAAACTTTGAATGTAGAAAGTGTTGAATAGCAAAAATGAGATTGCAGTTACTAATTATATTTTCACTACAAACCCTGCAACGTGGTAATAGCGATGCTGGTAGGATTACATGGTTTAGCACCAGGTTGTCAATGTACCTGATTTGACAACCTTTCAGCTACTAATTATCTGTTCATTATAATCCCTCCAATGTGGGAATAGTGATGCCGGTATGATTACAGAGTTAAGCAGCAATTTCTGAATTTTGTGACGTTCACTCGGAAATGAATCTTAGTGTTTCTTTTAAAGGTTATTTGCGTGCTTGTATTGTATGTCTTATATTATGTGCACTCGCTACTCATGCAGCTTGGCGTTGATACCGTCCCAGTACTTGTCGGACCAGTCTCATACTTG
Type
EST
SNP
PCR primers
BF201102A_R1 GCTGCTTAACTCTGTAATCATACC
BF201102_cpF1 AGACCGTTACTCATGGACCG
Sequence
NSFT03P2_Contig18820
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01