Query (optional)   in Class  

GrainGenes Probe Report: BF201102-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201102-5B
Data at Wheat_SNP
BF201102-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;G>T;A>G;T>A;G>A at 130;373;388;442;548
SNP A>G;T>A;G>A at 388;442;548
SNP A>G at 102
Reference sequence CCACCGTCCCTGCTATGGAGATGACCAAGTGGTTCGACACCAACTAGTAAGTCCATCGGATTCTACCTAAGATTGTTCTCGCATAGTTTATTCTGTATCTAATACTTTTACTAACGACATCTTTTACTATTACAGCCACTTTATCGTCCCTGAATTGGCTCCCAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAACGAGTACAAGGAGGCTAAGGCGGTATGATAGTAGAATCATATATTAGCTGACTTCCTTTATCTTGTGAAATTTTACCCTTGTGATGTTAGCCTGCCTAATTGTTATTTCACATCTCAAGTGATAGTAGTAATAAACTATTTCTTATTCCTACATTTGCTTAACTGTTTTGAACTAGTAAAAGAGTTGCAATTTACAGTAAGGTGCAGTTTTACATTGACATTTCAGAACATTCTCACTCTTGTCTGATCAAATTGGTTAATGGCCAACCAAGTAACTCTAATAGTTACTTTATATAGTTGTAACATCTCATTACCATAGGTCCTGTGCTTAAAAACTTTGAATGTAGAAAGTGTAGAATAGCAAAAATGAGTTTGCAGTTACTAATTATATTTTCACTACAAACCCTGCAACATGGCAATAGCGATGCTGGTAGGATTACATGGTTTAGCACCAGGTTGTCAATGTAGCTGATTTGATAAGTTTCCAGTTACTAATTATCTGTTCATTATAAATCCCTGCAATGTGGGAATAGTGATGCCAGTATGATTACAGAGTTAAGCAGCAATTTCTGAATTTTGTGACGTTTCACTTGGAAATGAATCTTCGTGTTTCTTTTAAAGGTTGTTTGTGTGCTTGTATTGTATGTCTTATATTATGTGCACTTGCTACTCATGCAGCTTGGCGTTGATACCGTCCCAGTACTTGTCGGAC
Reference sequence GCTGCTGTGTTAATCAAATCTCAAGTGATAGCAGTAATAAACTATTTCTTATTCCTACATTTGCTTAACTGTTTTGAACTAGTAAAAAGAGTTGCAATTTACATTAAGATGCAGTTTTACATTGACATTTCAGAACATTCTCACTCTTGTCTGATCAAATTGGTTAATGGCCAACTAAGTAACTCTAATAATTACTTTATATAGTTGTAACATCTCATTACCATAGGTCCTGTGCTGAAAACCCTTTGAATGTAGAAAGTGTAGAATAGCAAAAATGAGTTTGCAGTTACTAATTATATTTTCACTACAAGCCCTGCAACGTGGCAATAGCGATGCTGGTAGGATTACATGATTTAGCACCAGGTTGTCAATGACCTGATTTGACAAATTTCCAGTTACTAATTATCTGTTCATTATAATCCCTGCAATGTGGGAATAGTGTTGCCAATATGATTACAGAGTTAAGCAGCAATTTCTGAATTTTGTGACGTTCACTCGGAAATGAATCTTCGTGTTTCTTTAAAGGTTGTTTGCGTGCTTGTATTGTGTGTCTTATATTATGTGCACTCGCTACTCGTGCAGCTTG
Type
EST
SNP
Sequence
NSFT03P2_Contig18820
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01