Query (optional)   in Class  

GrainGenes Probe Report: BF201102-5D

Probe
BF201102-5D
Data at Wheat_SNP
BF201102-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;T>C at 491;759
SNP C>A;A>G; at 510;688
SNP G>A;G>C;T>C at 505;711;773
Reference sequence GGCTAGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCAAGTGGTTTGACACCAACTAGTAAGTCCACCGGATTCTACCTAAGGTTGTTCTCACATAGTTTATTCTGTATCTAGTACTTTTACTAACGACATCGTTTACTATTACAGCCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGGTATGATAGTAGAATCATATATTAGCTGACTTCCTATATCTTTTGAAATTTTACCATTGTGATGTTAGCCTGCCTAATTGTTATTTTTGAACACACAAGCGTTGTGATAACAGCCTGATCACTCTAGAATGCCGCTGTTTTAATCAAATCTAAGTGATAGTAGTAATATACTAGTATTTCTTATTCCTACATTTGCTTAACTGTTTTTTAACTAGTAAAAGAGTTTTAATTTACATAAGGTGCAGTTTTACATTGACATTTCAGAACGTTCTCACTCTAATAATTACTTTATAGTATAGTTGTAACATCTCATTACCATTGGTCCTGTTCTGAGAACTTTGAATGTAGAAAGTGTAGAATAGCAAAAATGAGAGTTTGCAGTTACTAATTAGATTTTCACTACACGCCCTGCAACATGGGAATAGCGATGCTGGTAGGATTACATGGTTTAGCAGCAGGTTGTCAATGTACCTGATTTGACAAGTTTTCAGTTACTAATTATCTGTTCATTATAATCCCTGCGATATGAGAATAGTGATGCCAGTGTGATTACAGAGTTAAGAAGCAATTTCTGAATTTTGTGACGTTCTCTCGGAAATGAATCTTCGTGTTCCTTTTAAAGGTTATTTGCGTGCTTGTATTGTATGTCTTATATTATGTGCACT
Reference sequence CCACCGTCCCTGCTATGGAGATGACCAAGTGGTTTGACACCAACTAGTAAGTCCACCGGATTCTACCTAAGGTTGTTCTCACATAGTTTATTCTGTATCTAGTACTTTTACTAACGACATCGTTTACTATTACAGCCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGGTATGATAGTAGAATCATATATTAGCTGACTTCCTATATCTTTTGAAATTTTACCATTGTGATGTTAGCCTGCCTAATTGTTATTTTTGAACACACAAGCGTTGTGATAACAGCCTGATCACTCTAGAATGCCGCTGTTTTAATCAAATCTAAGTGATAGTAGTAATATACTAGTATTTCTTATTCCTACATTTGCTTAACTGTTTTTTAACTAGTAAAAGAGTTTTAATTTACATAAGGTGCAGTTTTACATTGACATTTCAGAACGTTCTCACTCTAATAATTACTTTATAGTATAGTTGTAACATCTCATTACCATTGGTCCTGTTCTGAGAACTTTGAATGTAGAAAGTGTAGAATAGCAAAAATGAGAGTTTGCAGTTACTAATTAGATTTTCACTACACGCCCTGCAACATGGGAATAGCGATGCTGGTAGGATTACATGGTTTAGCAGCAGGTTGTCAATGTACCTGATTTGACAAGTTTTCAGTTACTAATTATCTGTTCATTATAATCCCTGCGATATGAGAATAGTGATGCCAGTGTGATTACAGAGTTAAGAAGCAATTTCTGAATTTTGTGACGTTCTCTCGGAAATGAATCTTCGTGTTCCTTTTAAAGGTTATTTGCGTGCTTGTATTGTATGTCTTATATTATGTGCACTTGCTACTCATGCAGCTTGGCGTTGATACCGTCCCCGTACTTGTCGGAC
Type
EST
SNP
PCR primers
BF201102_cpF1 AGACCGTTACTCATGGACCG
BF201102D_R1 AGACTGGTCCGACAAGTACG
Sequence
NSFT03P2_Contig18820
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01