Query (optional)   in Class  

GrainGenes Probe Report: BF201426-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201426-6A
Data at Wheat_SNP
BF201426-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C at 624
Reference sequence TAGCCTCCCCGCCCTTCCATTCGATCCACCACCACCGGTGTTCGCTTGAGACCTCGTATTCCCAAGAGTCTGCAAGGAGAAATGCGATTGGGTTAGAGTAGTAGGTTAATTGATGCCAAGTGCGAAATGGGAAATTGAGAGATAGTGGTGATGGTTCAGAGACATGGATCGGATTTGAGTCGTAGAGAGGAAACGAAATTGGCACAGGCACGTCTAAGATCCACTCAACCCCTTGCTTGTAATAATAAGATTATACTCCCTCGGTTCCTAAATACTCCTATAAGTCTTTTTAGAGATTTCAAAATGAACTACATACGGATGTATATAGACGTAGTTTAGAGTGTAGATTCACTCATTTTGCTCCATATGTAGTCCATGTTGCAATCTCTAAAAATACTTATATTTAGGAATGGAGGGAGTATCACCAAGACTTGCAGGCCATGTCACTATCGCTTTTTTCCTGTTATTCCAGCATCTGTGTGGCCTGCGATGATGTGAACTGATAAGCCGTTGCCCATTTGCAGTTGGATGAAGCTGCTCCGGTTCTTGCTGGGCTGAGCACGCCAATTGTAGTCGCGAAAGTAAATGCAGAGAAATACAAAAAGCTTAGGTCCAAATATGGAGTAGAGTAAGCAACCTAATCAAATATCTCTACGAGTTTGGTTAAACCAGGTGGGAGTCTGTTTTGTAATTGACAAATTTGTTTGTTTTCCTGGATGCAGTGGCTTCCCCACTC
Type
EST
SNP
PCR primers
BF201426A_F1_UCW GCAGGTACGCATCCAGGTAG
BF201426A_R1_UCW TGGTCAAAAAGCATGAGAGTG
Sequence
NSFT03P2_Contig12809
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01