Query (optional)   in Class  

GrainGenes Probe Report: BF201560-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201560-7D
Data at Wheat_SNP
BF201560-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 229
SNP A>T;G>A;T>C at 61;581;593
Reference sequence GACAAGACTACTGATAAGACAACTTCATCCAAACAATCAGATGTTCCTGATGAATGGGAATCGGAGAAAACGATCAGGAAATCAACCAGAACATCTGTCATTGTGAGACAAGCTGAACGAGAAGCAATACGTGCTGAAAAGCAAGCAACTGCTAAGGTCTGTATCCATACAGCAGCCCTCCACGCATTACATTCATGGTTATTAGTATTCAGGGACAACATAATCTTGTAGTACCCAACAATTGGCATTTTCAGGCTGATTGATTGTTTTCCCTCTTTTATACTGTGCCAGCCAATTAAGAAGAGAAAAGAGGGAGAAGAAAAACGTATGACACAAGAAGAGATGCTCT
Reference sequence TCATCTGTTCATTGGTTACTTATTTATTGTAGCTTTTGTTGTTGGTCTTCTCTTTGCTCAAAATAATTTTCCCACTGCCTGTGCTAATCCAACTCCTTTCCAGGAACCTCAACCTGACGACGACCCAGAGAAGGAAGTGAGTGAGAGGTAACACATGTTTCACGTTAGCCCATAAGCATATCGGAGCACAGTCATGCACTGCGTAACAGTCAGTTATATATTCTAAATCGTGCCCTGATTATGGACCAGATTACCTATTAAGAAGCGGCTATTTTTCCCTGGGAAGACCATGAAAAAAATGAAAGCCAAGAAGAAGAAAAAGAAGAATAAGGTCATCAAACTAGAGGATGATGAAGGTATAGATGACAAGACTACTGATAAGACAACTTCATCCAAACAATCAGATGTTCCTGATGAATGGGAATCGGAGAAAACGATCAGGAAATCAACCAGAACATCTGTCATTGTGAGACAAGCTGAACGAGAAGCAATACGTGCTGAAAAGCAAGCAACTGCTAAGGTCTGTATCCATACAGCAGCCCTCCACGCATTACATTCATGGTTATTAGTATTCAGGGACGACATAATCTTGTAGTACCCAACAATTGGCATTTTCAGGCTGATTGATTGTTTTCCCTCCTTTATACTGTGCCAGCCAATTAAGAAGAGAA
Type
EST
SNP
PCR primers
BF201560_cpR1 CAGCTGCTTCCAAGAGCATC
BF201560D_F3 TGAAGGTATAGATGACAAGACTA
Sequence
NSFT03P2_Contig10296
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01