Query (optional)   in Class  

GrainGenes Probe Report: BF201830-2A

Probe
BF201830-2A
Data at Wheat_SNP
BF201830-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 421-444
SNP A>G at 589
Reference sequence CCCAGGCTGAAGCTTGAGTCGTCATGGTTTTTGCCCATGTCAGTAATGTCTGGACCTGAACAGCAGGAAAATCTAGACGATCATAATAAGAACGCAGATCGATTCAGAATGGCAGCAACCAATGCGCTAAAAGCACGTTAATTAAGTAGTTAACGCATCTTATTTTCCCACCTCGTTTGCGATAAGCCGAATCAACCGTGGATCCTTCCATGAGGAAAATTGGAAATCATCAAGACATGTTAAAAGCAGCAGCATGCATCTAAATGCTGCTGTGCATGTGTGCTATTGACTTCTTTATGAGATGTAACTTGACTTCACTCGATGCATGCAGGAAAGGGAAGTGATCCTGAATGGAACGAAACCTTTGTGTTCACCGTCTCTGAGAATGCAACCGAGCTCGTCATCAAGCTCCTCGACAGTGATGGTGGCACGGACGACGACAGCGTTGGTGAAGCAACGTAAGTCGAAATGAGCTAGGAGTAGCAATTTTGGTCCTGTGTCAGTTTCTATCCCTGAAGATGTGGCCAACCCAGAGTGTTCCTTTGAGTTAGTTGTGGGGCTGGCGGTCTTACATAAAACTGGCTCAAATGTTTGGCGAAATCTGTTTTTGAAACACTTGCAGTTTGCATTTCGATTGATGTCGCAGCATCGCGGGATGCAAAATTGAATGATCGCAGATTGCATCATCCACTACAACTCTGAGTATTTGATTCTTTCAGGATCCCATGGATGGAGTGTACACTGAAGGAACATC
Reference sequence TGGTGGGATGCTTCCTTCAGTGTACACTCCATCCAATGGGATCCTGAAAGAATCAAATACTCAGAGTTGTAGTGGATGCTGCAATCTGCGATCATTCAATTTTGCATCCTGCGATGCTGCGACATCAATCGAAATGCAAACTGCAAGTGTTTCAAAAACAGATTTCGCCAAACATTTGAGCCAGTTTTATGTAAGACCGCCAGCCCCACAACTAACTCAAAGGAACACTCTGGGTTGGCCACATCTTCAGGGATAGAAACTGACACAGGACCAAAATTGCTACTCCTAGCTCATTTCGACTTACGTTGCTTCACCAACGCTGTCGTCGTCCGTGCCACCATCACTGTCGAGGAGCTTGATGACGAGCTCGGTTGCATTCTCAGAGACGGTGAACACAAAGGTTTCGTTCCATTCAGGATCACTTCCCTTTCCTGCATGCATCGAGTGAAGTCAAGTTACATCTCATAAAGAAGTCAATAGCACACATGCACAGCAGCATTTAGATGCATGCTGCTGCTTTTAACATGTCTTGATGATTTCCAATTTTCCTCATGGAAGGATCCACGGTTGATTCGGCCTATCGCAAACAAGGTGGGAAAATAAGATGCGTTAACT
Type
EST
SNP
PCR primers
BF201830A_F1 GCACTGGTACTGAATGAGTCCTAGG
BF201830_cpR1 GGAGTGAACGTCAGACCGAT
Sequence
NSFT03P2_Contig16104
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01