Query (optional)   in Class  

GrainGenes Probe Report: BF201830-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201830-2B
Data at Wheat_SNP
BF201830-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;DEL;INS;A>T at 186;195;213,3;215
[ Show all 8 ]
Type
EST
SNP
PCR primers
BF201830B_F1 CACTGGTGCTGAATGAGTGTC
BF201830_cp1R GGAGTGAACGTCAGACCGAT
Sequence
NSFT03P2_Contig16104
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01