Query (optional)   in Class  

GrainGenes Probe Report: BF201830-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF201830-2D
Data at Wheat_SNP
BF201830-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>T;A>C;A>C at 85;250;392;394
[ Show all 7 ]
Type
EST
SNP
PCR primers
BF201830_cpR1 GGAGTGAACGTCAGACCGAT
BF201830D_F1 AACGCTTTCCTTCACTAGTAGTGTTCT
Sequence
NSFT03P2_Contig16104
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01