Query (optional)   in Class  

GrainGenes Probe Report: BF202681-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF202681-2A
Data at Wheat_SNP
BF202681-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;G>A at 302;209
SNP T>G;T>A;C>G;G>A at 226;228;247;263
Reference sequence TCACTTGCTGCTAATTGGGCTGTGATTGTTAAACGATATAACAGCTGCATTGGAAATGACAACACCAGCAATTTGTGAAAGAATCAAAGAAACGACTGTGAAGTACCTGCAAGGCTATTGGGATTGTCACCTGACCACTGAATAACCAAACAGTTCTTGTCAAACTGATGCCTGCAAATGCATATTGCATCAATAAACTTATGGGATGGTACTGCAATAATCTTCATTGCTTCTGCCATTAGGATGGCACTTGTTAAGACCATTAAGCTAGCTTACCTGTTAATAAATTATTTCTATAATCGAGGGTGCCTAAAATACAATTAGTAATAGATTCCCTTCGACAGCAAAAAAGAGGATTGACAGAAAATACTGGAGTTCCAGAGTTGCAGGTGTACACTTAATTGACAAGTAGCATAAAAAGAACATAACCATATTTGTACAGATGCACCACACAAGTGCAGCAGTAAAACAAGAACTCACCTTTCTACAAAATATGAAGAAATCCGACCTGCAGCTGCATATGCCGGTGCCAGATTTCCCAACTTCTGTTCAAGATCAGGAGCAGTAGCCTGGAGGAGGAAGTGCACAATTTTGATATTTTATTCTTAGAGAAATGTGAAATTTGTTTAAATACTTTTCATATTTAAGCCATTCAAGAAATCTGGTGTGTAGCTAAACAGACAAGGGGTGAACCTCTAAAACAGCTTTTGACCAGGTCCTCTTGTTTATATCCA
Reference sequence CGCTTGAAAAGAAAATACAACACAACTGATACAGGATCCTTGCAACTCACTGTGTCACTAGTACCAAGGCTGATTGCAAGATCGCCAGGTGTATTCAGTGTCAAACCTACAATGCAATGGTCCAATGGAACGTTAAGATGAATAGAGGAAAGTAATAATCACTTGCTGCTAATTGGGCTGTGATTGTTAAACGATATAACAGCTGCATTGGAAATGACAACACCATCTATTTGTGAAAGAATCAAACAAACGACTGTGAAGTGCCTG
Type
EST
SNP
PCR primers
BF202681A_R1 CGCCAGGTGTATTCAGTGTC
BF202681_cpF1 ATGGCATCTATCCTTGCTGG
Sequence
NSFT03P2_Contig11212
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01