Query (optional)   in Class  

GrainGenes Probe Report: BF202681-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF202681-2B
Data at Wheat_SNP
BF202681-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>A;G>T;A>T;G>T;DEL at
SNP C>G;DEL;G>T;T>C;G>A at 38;57;421;542;697
Reference sequence GGATATAAACCAGAGGACCTGGTCAAAAGCTGTTTTAGAGGTTTGGCCCTTGTCTGTTTAGCTACAACCAGATATCTTGAATGGCTTGAATATAAAAAATATTTTAAATAAATTTCACATTTCTCTAAGAATAGAATATCAAATTGTGCACTTCCTCCTCCAGGCAACTGCTCCTGATCTTGAACAGAAGCTGGGAAATCTGGCACCGGCATATGCAGCTGCAGGTCGGATTTCTTCATATTTTGTAGAAAGGTGGGTTCTTGTTTTACTGCTGCACTCTTTGGTGCATCTGTAAAAATATGGTTACGTTCTTTTTATGCCACTTGGTAATTAAGTGTACACCTGCAAATCTGTAACTCCAGTATTTATCTGTCAATTTTCTTTTTCGCTGTCAAAGGGAATCTATTAGTAATTAGATTTTAGGCACCCTATATTATAGAAATAATTTGTTAACAGGTAAGCTAGCTTAATGGTCTTAACAAATGCAATCCTAATGGCAGAAGCAATGAAGATTATTTGTAGCATCATCCCATAAGTTTATTGATGCAATATGCATTTGCAGGCATCAGTTTGACAAGAACTGTTTGGTTTTTCAGTGGTCAGGTGACAATCCCAATAGCCTTGCAGGTACTTCACTGTCATTTCTTGGATTCTTTTATGAATTGCTGGTGTTGTCATTTTCAATGCAGCAAGTGGATGTATCATTTAACAATCACAGCCCA
Reference sequence CTTGATGGATATAAACCAGAGGACCTGGTCAAAAGCTCTTTTAGAGGTTTGACCCTTGTCTGTTTAGCTACAACCAGATATCTTGAATGGCTTGAATATAAAAAATATTTTAAATAAATTTCACATTTCTCTAAGAATAGAATATCAAATTGTGCACTTCCTCCTCCAGGCAACTGCTCCTGATCTTGAACAGAAGCTGGGAAATCTGGCACCGGCATATGCAGCTGCAGGTCGGATTTCTTCATATTTTGTAGAAAGGTGGGTTCTTGTTTTACTGCTGCACTCTGTGGTGCATCTGTAAAAATATGGTTACGTTCTTTTTATGCCACTTGGTAATTAAGTGTACACCTGCAAATCTGTAACTCCAGTATTTTCTGTCAATTTTCTTTTTCGCTGTCAAAGGGAATCTATTAGTAATTAGATTTTAGGCACCCTATATTATAGAAATAATTTGTTAACAGGTAAGCTAGCTTAATGGTCTTAACAAATGCAATCCTAATGGCAGAAGCAATGAAGATTATTTGTAGCATCATCCCATAAGTTTATTGATGCAATATGCATTTGCAGGCATCAGTTTGACAAGAACTGTTTGGTTATTCAGTGGTCAGGTGACAATCCCAATAGCCTTGCAGGTACTTCACTGTCATTTCTTTGATTCTTTTATGAATTGCTGGTGTTGTCATTTTCAATGCAGCTGTTATGTATCATTTAACAATCACAGCCCAATTAGCAGCAACTGATTATTACTTTCCTCTATTCATCATTAACATTCCATTGGACAATTGCATCTATTGTAGGTTTAACACTGAATACACCTGGCGATCTTGCAATCAGCCTTGGTACTAGTGACACAGTGAGTTGCAAGGATCCTGTTTCAGTTTCGTGTA
Type
EST
SNP
PCR primers
BF202681B_R1 CAATAGATGCAATTGTCCAATGGAAT
BF202681_cpF1 ATGGCATCTATCCTTGCTGG
Sequence
NSFT03P2_Contig11212
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01