Query (optional)   in Class  

GrainGenes Probe Report: BF202765-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF202765-3B
Data at Wheat_SNP
BF202765-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>C;C>A;T>G at 6;7;704;707
Reference sequence AATTTCACCCATTAAACAGTAATCCACGTCTCATGGGTGCAGTGTTTGAGTTTGAACAAAATAACGAAAACAACCCAATTTTTTATGGAGAGCAGAATCATTTGGTTGTTGAGCAACTAAGTTGTACTTGTTTGTTCCATTAAACAAGGATGTTACCGTATGAAGTTACATGTCCATAGGTTGAGTTGCCATAATACAGATAAAACATAAATGGAGGCTAGGTGCATGCAAAGTCAACTTAGAGTGGCGGTAATTTAGTGAAGGCAAGGGAAGAAAACTATAGAAATATATACAGTAGTCATTAATTAACTGTACAATGAGGCTACCAAACCATCACTTTTCTTATGTTAACTCCACATAATTGGAAATCTAGCAAATTTTGTATTACAAAGGGCACAGTCGGATCTGGTAAATTTTCTTACAACTAAGGAATCTAGCGTGTCCTTATAGTCCTGTTTATCCTGCTAGCAAAGTAAGTTTTCTCCGCAAGGTAAAAAAAAAGCTAATTGCAGATGGTATACATGTACATTAATTTTTTGGCACGTATATGTTCCTTGTACTTTGTATTTGTTGTAACTCTTCCACGCCAACAGTTTCTGAAGAAACCTGCAACGAAGTTGAGAGCTTGGTCTTCGATCTTTTTGCAAATCTGGGTGCCACAGGTGCATTTCTAGCAATTCAAATTGGTTTGCCTTAGAATTTTCTTTTCTTTTTTAGTGACATTGTTTTGTTTGCATATTACAGAAGAACAGCTAGATTTCCCAGTTCTTTATGCATC
Reference sequence ATCCTTCCTCCTCAACAAGGTTGATAGGCCTTCAGGTATGCTCATTACCAGAAATTTCACCCATTAAACAGTAATCCACGTCTCATGGGTGCAGTGTTTGAGTTTGAACAAAATAACGAAAACAACCCAATTTTTTACGGAGAGCAGAATCATTTGGTTGTTGAGCAACCAAGTCTGTACTTGTTTGTTCCATTAAACAAGGATGTTACCGTATGAAGTTGCATGTCCATAGGTTGAGTTGCCATAATACAGATAAAACATAAATGGAGGCTAGGTGCATGCAAAGTCAACTTAGAGTGGCGGTAATTTAGTGAAGGCAAGGGAAGAAAACTATAGAAATATATACAGTAGTCATTAATTAACTGTACAATGAGGCTACCAAACCATCACTTTTCTTATGTTAACTCCACATAATTGGAAATCTAGCAAATTTTGTATTACAAAGGGCACAGTCGGATCTGGTAAATTTTCTTACAACTAAGGAATCTAGCGTGTCCTTATAGTCCTGTTTATCCTGCTAGCAAAGTAAGTGTTCTCCGCAGGGGTAAAAA
Type
EST
SNP
Sequence
NSFT03P2_Contig15052
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01