Query (optional)   in Class  

GrainGenes Probe Report: BF291316-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF291316-4A
Data at Wheat_SNP
BF291316-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;G>T;T>C;C>T;T>C;G>T;C>G;C>T at 68;101;104;126;134;173;280;413
Reference sequence GGATCAACCTCAAGTTTGACAGCCCCAGTGGCACCGGGACGATGTCGTCCGCGAGGTCCTTCATGTCATCTTTGAGCATGGACGGCAGTGTGGCCAGCCTGGATGCCAAGTCTTCCTCCTTCCATCTGATCGGTGGGCCTGCTATGAGCGACCCGGTGAACGCGCAGCAGGCGCCGAGGAGGCGGTGCTCGGGACGTGGGGAGGATGGAAATGGCAAGTGTGCTGCAACTGGCAGGTGCCATTGTTCTAAGAGAAGGTAGTAAATCTGCTATCTTTGGTCTTTCTGATTCTTTTGATTCAAGACAGGGCACCATGATAATTGTTATCTACCCTATTTCAGCAGGAAGTTGCGGGTGAAGAGGACGATTAAAGTTCCCGCAATTAGTAATAAAATTGCTGATATACCTCCAGACGAATACTCCTGGAGGAAGTATGGGCAGAA
Type
EST
SNP
Sequence
NSFT03P2_Contig16503
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01